FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623272_at:

>probe:Drosophila_2:1623272_at:69:361; Interrogation_Position=119; Antisense; GCAAGTGTACTCAGGTGGCCATCGA
>probe:Drosophila_2:1623272_at:490:41; Interrogation_Position=139; Antisense; ATCGAAACACTGACCAGCCTGGCCG
>probe:Drosophila_2:1623272_at:424:125; Interrogation_Position=154; Antisense; AGCCTGGCCGATAAAATCGTCCCGA
>probe:Drosophila_2:1623272_at:539:39; Interrogation_Position=169; Antisense; ATCGTCCCGACCGTATATGAGTTGA
>probe:Drosophila_2:1623272_at:662:615; Interrogation_Position=199; Antisense; TGCTCCGGATACGTAACTTTGGAAC
>probe:Drosophila_2:1623272_at:339:455; Interrogation_Position=21; Antisense; GATCAAGTCCATATTTCTGCTCAGT
>probe:Drosophila_2:1623272_at:352:187; Interrogation_Position=287; Antisense; AACTTGTCTTTGACGAACCCAAATG
>probe:Drosophila_2:1623272_at:572:309; Interrogation_Position=305; Antisense; CCAAATGTCTGCACGGTCTACTGAA
>probe:Drosophila_2:1623272_at:450:533; Interrogation_Position=319; Antisense; GGTCTACTGAACAAGTTGGCTGCCA
>probe:Drosophila_2:1623272_at:218:467; Interrogation_Position=333; Antisense; GTTGGCTGCCACAATCAAACCATTT
>probe:Drosophila_2:1623272_at:229:239; Interrogation_Position=345; Antisense; AATCAAACCATTTGCCGAGCAGATA
>probe:Drosophila_2:1623272_at:533:641; Interrogation_Position=36; Antisense; TCTGCTCAGTATTTTGGCTGTCTGC
>probe:Drosophila_2:1623272_at:39:459; Interrogation_Position=366; Antisense; GATATCGGGATTAGGTTGCTTGGAC
>probe:Drosophila_2:1623272_at:205:549; Interrogation_Position=78; Antisense; GGAGGCCCAGGCCACTATAAGTGAA

Paste this into a BLAST search page for me
GCAAGTGTACTCAGGTGGCCATCGAATCGAAACACTGACCAGCCTGGCCGAGCCTGGCCGATAAAATCGTCCCGAATCGTCCCGACCGTATATGAGTTGATGCTCCGGATACGTAACTTTGGAACGATCAAGTCCATATTTCTGCTCAGTAACTTGTCTTTGACGAACCCAAATGCCAAATGTCTGCACGGTCTACTGAAGGTCTACTGAACAAGTTGGCTGCCAGTTGGCTGCCACAATCAAACCATTTAATCAAACCATTTGCCGAGCAGATATCTGCTCAGTATTTTGGCTGTCTGCGATATCGGGATTAGGTTGCTTGGACGGAGGCCCAGGCCACTATAAGTGAA

Full Affymetrix probeset data:

Annotations for 1623272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720