FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623273_at:

>probe:Drosophila_2:1623273_at:230:149; Interrogation_Position=1037; Antisense; ACTTATCAAGCGGTGCAGGGCCAAT
>probe:Drosophila_2:1623273_at:156:267; Interrogation_Position=1052; Antisense; CAGGGCCAATGGTCTTGCAAGCATT
>probe:Drosophila_2:1623273_at:240:679; Interrogation_Position=604; Antisense; TAGTACCCATCATTAGTCCCGAGGT
>probe:Drosophila_2:1623273_at:642:579; Interrogation_Position=632; Antisense; GGCCACCGGAGATCATGACTTGGAT
>probe:Drosophila_2:1623273_at:441:665; Interrogation_Position=696; Antisense; TACAAGGCTCTTAGTGATCACCACG
>probe:Drosophila_2:1623273_at:613:453; Interrogation_Position=711; Antisense; GATCACCACGTTTTTCTCGAGGGAA
>probe:Drosophila_2:1623273_at:230:435; Interrogation_Position=729; Antisense; GAGGGAACTCTTTTGCAACCCAGCA
>probe:Drosophila_2:1623273_at:188:433; Interrogation_Position=805; Antisense; GAGTGGCTACAGTTCTCGCCATTAG
>probe:Drosophila_2:1623273_at:398:313; Interrogation_Position=822; Antisense; GCCATTAGGCGAAGTGTTCCTCCGG
>probe:Drosophila_2:1623273_at:490:87; Interrogation_Position=857; Antisense; AGTACTTTTTTGTGGTGGCGCTCAA
>probe:Drosophila_2:1623273_at:730:439; Interrogation_Position=891; Antisense; GAGGCCACGGTCCATTTGAATGCAA
>probe:Drosophila_2:1623273_at:430:693; Interrogation_Position=931; Antisense; TTTGTAAGCCTTGGGCCATGACCTT
>probe:Drosophila_2:1623273_at:19:57; Interrogation_Position=948; Antisense; ATGACCTTTGCCTTTGATCGGGCTC
>probe:Drosophila_2:1623273_at:687:449; Interrogation_Position=963; Antisense; GATCGGGCTCTTCAAACATCGATTT

Paste this into a BLAST search page for me
ACTTATCAAGCGGTGCAGGGCCAATCAGGGCCAATGGTCTTGCAAGCATTTAGTACCCATCATTAGTCCCGAGGTGGCCACCGGAGATCATGACTTGGATTACAAGGCTCTTAGTGATCACCACGGATCACCACGTTTTTCTCGAGGGAAGAGGGAACTCTTTTGCAACCCAGCAGAGTGGCTACAGTTCTCGCCATTAGGCCATTAGGCGAAGTGTTCCTCCGGAGTACTTTTTTGTGGTGGCGCTCAAGAGGCCACGGTCCATTTGAATGCAATTTGTAAGCCTTGGGCCATGACCTTATGACCTTTGCCTTTGATCGGGCTCGATCGGGCTCTTCAAACATCGATTT

Full Affymetrix probeset data:

Annotations for 1623273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720