FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623275_at:

>probe:Drosophila_2:1623275_at:683:267; Interrogation_Position=1159; Antisense; CAGGCTGGCTTAAAAATTCTGCAGG
>probe:Drosophila_2:1623275_at:583:179; Interrogation_Position=1170; Antisense; AAAAATTCTGCAGGCATCCTTCTCG
>probe:Drosophila_2:1623275_at:495:71; Interrogation_Position=1181; Antisense; AGGCATCCTTCTCGTACTTCACATT
>probe:Drosophila_2:1623275_at:378:489; Interrogation_Position=1194; Antisense; GTACTTCACATTCCTCACTTCGATG
>probe:Drosophila_2:1623275_at:615:649; Interrogation_Position=1208; Antisense; TCACTTCGATGCAGCGACGACAAAT
>probe:Drosophila_2:1623275_at:387:71; Interrogation_Position=884; Antisense; AGGCTTATACGAATCCTATGGCTAA
>probe:Drosophila_2:1623275_at:408:367; Interrogation_Position=894; Antisense; GAATCCTATGGCTAATTACATCTAT
>probe:Drosophila_2:1623275_at:265:571; Interrogation_Position=903; Antisense; GGCTAATTACATCTATGCGATTTGG
>probe:Drosophila_2:1623275_at:720:49; Interrogation_Position=917; Antisense; ATGCGATTTGGTTTGGTGCTAAGAC
>probe:Drosophila_2:1623275_at:248:509; Interrogation_Position=932; Antisense; GTGCTAAGACAGTTGAGCTGCTTTC
>probe:Drosophila_2:1623275_at:618:417; Interrogation_Position=946; Antisense; GAGCTGCTTTCTTTAGGACAGATTG
>probe:Drosophila_2:1623275_at:186:401; Interrogation_Position=962; Antisense; GACAGATTGGTTCCGACTTGGCCTT
>probe:Drosophila_2:1623275_at:496:591; Interrogation_Position=972; Antisense; TTCCGACTTGGCCTTTACTACGGAT
>probe:Drosophila_2:1623275_at:26:581; Interrogation_Position=980; Antisense; TGGCCTTTACTACGGATTCCCTCAG

Paste this into a BLAST search page for me
CAGGCTGGCTTAAAAATTCTGCAGGAAAAATTCTGCAGGCATCCTTCTCGAGGCATCCTTCTCGTACTTCACATTGTACTTCACATTCCTCACTTCGATGTCACTTCGATGCAGCGACGACAAATAGGCTTATACGAATCCTATGGCTAAGAATCCTATGGCTAATTACATCTATGGCTAATTACATCTATGCGATTTGGATGCGATTTGGTTTGGTGCTAAGACGTGCTAAGACAGTTGAGCTGCTTTCGAGCTGCTTTCTTTAGGACAGATTGGACAGATTGGTTCCGACTTGGCCTTTTCCGACTTGGCCTTTACTACGGATTGGCCTTTACTACGGATTCCCTCAG

Full Affymetrix probeset data:

Annotations for 1623275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720