Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623276_at:

>probe:Drosophila_2:1623276_at:60:251; Interrogation_Position=3063; Antisense; CAATCATTGGGTCGCAATCGGGCCG
>probe:Drosophila_2:1623276_at:212:401; Interrogation_Position=3087; Antisense; GACAGTGCCCCGAAATTGAATCACA
>probe:Drosophila_2:1623276_at:154:653; Interrogation_Position=3118; Antisense; TCAAGAATATTTCACAGCCCGCCTT
>probe:Drosophila_2:1623276_at:545:305; Interrogation_Position=3155; Antisense; CCTGGAGGGCGTGGAATCAACATTT
>probe:Drosophila_2:1623276_at:586:189; Interrogation_Position=3173; Antisense; AACATTTTTTCCCAGCCGCATGAAA
>probe:Drosophila_2:1623276_at:327:599; Interrogation_Position=3214; Antisense; TGTTAACTTCAATACCCGCTGTGGA
>probe:Drosophila_2:1623276_at:723:241; Interrogation_Position=3224; Antisense; AATACCCGCTGTGGATTTATCCGTA
>probe:Drosophila_2:1623276_at:103:293; Interrogation_Position=3245; Antisense; CGTAATACCCAGCTCCATGTTAATG
>probe:Drosophila_2:1623276_at:566:213; Interrogation_Position=3274; Antisense; AAGAGGGTCGCAAGGTCATTCCGGA
>probe:Drosophila_2:1623276_at:253:425; Interrogation_Position=3300; Antisense; GAGACGGAGTTGCACGCCTCGAAAA
>probe:Drosophila_2:1623276_at:488:227; Interrogation_Position=3348; Antisense; AAGGCGGAATCGACGGCACAGCAGC
>probe:Drosophila_2:1623276_at:79:389; Interrogation_Position=3395; Antisense; GAAAAGTCCACCGTTGCAGCAGGAT
>probe:Drosophila_2:1623276_at:595:235; Interrogation_Position=3427; Antisense; AATCCGATGCCACTTGATGGACTGC
>probe:Drosophila_2:1623276_at:255:67; Interrogation_Position=3443; Antisense; ATGGACTGCCAACCCAATTCTCTGA

Paste this into a BLAST search page for me
CAATCATTGGGTCGCAATCGGGCCGGACAGTGCCCCGAAATTGAATCACATCAAGAATATTTCACAGCCCGCCTTCCTGGAGGGCGTGGAATCAACATTTAACATTTTTTCCCAGCCGCATGAAATGTTAACTTCAATACCCGCTGTGGAAATACCCGCTGTGGATTTATCCGTACGTAATACCCAGCTCCATGTTAATGAAGAGGGTCGCAAGGTCATTCCGGAGAGACGGAGTTGCACGCCTCGAAAAAAGGCGGAATCGACGGCACAGCAGCGAAAAGTCCACCGTTGCAGCAGGATAATCCGATGCCACTTGATGGACTGCATGGACTGCCAACCCAATTCTCTGA

Full Affymetrix probeset data:

Annotations for 1623276_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime