FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623277_at:

>probe:Drosophila_2:1623277_at:224:251; Interrogation_Position=3640; Antisense; CAAGGAGCCGCCTCAAAGGCTGGGT
>probe:Drosophila_2:1623277_at:637:313; Interrogation_Position=3649; Antisense; GCCTCAAAGGCTGGGTACCTAATAA
>probe:Drosophila_2:1623277_at:443:231; Interrogation_Position=3677; Antisense; AATGATTTCCAATTGTTAAGCGAGG
>probe:Drosophila_2:1623277_at:40:659; Interrogation_Position=3693; Antisense; TAAGCGAGGTGGATACTAGCAACTA
>probe:Drosophila_2:1623277_at:283:61; Interrogation_Position=3755; Antisense; ATGTCTATTATAGTGCATGCATTGA
>probe:Drosophila_2:1623277_at:259:23; Interrogation_Position=3796; Antisense; ATATGTATGTTGTGTGCAAGCCGAT
>probe:Drosophila_2:1623277_at:474:515; Interrogation_Position=3807; Antisense; GTGTGCAAGCCGATAGAACGTATAT
>probe:Drosophila_2:1623277_at:632:681; Interrogation_Position=3829; Antisense; TATGATGCCAAGAGTCAGTCCCACG
>probe:Drosophila_2:1623277_at:102:431; Interrogation_Position=3840; Antisense; GAGTCAGTCCCACGTAAAAAATCTA
>probe:Drosophila_2:1623277_at:243:459; Interrogation_Position=3941; Antisense; GTTGTGGTTTCATATAAGGTAGTCA
>probe:Drosophila_2:1623277_at:409:95; Interrogation_Position=3965; Antisense; AGATAGCCAAGTGACTCCCGTCAAA
>probe:Drosophila_2:1623277_at:394:491; Interrogation_Position=4047; Antisense; GTAAACCACTAGTCAGCGAACTTGT
>probe:Drosophila_2:1623277_at:249:443; Interrogation_Position=4058; Antisense; GTCAGCGAACTTGTACGAACACGTA
>probe:Drosophila_2:1623277_at:556:359; Interrogation_Position=4143; Antisense; GCAAGCAAATTGTCCTTTGTTTAAG

Paste this into a BLAST search page for me
CAAGGAGCCGCCTCAAAGGCTGGGTGCCTCAAAGGCTGGGTACCTAATAAAATGATTTCCAATTGTTAAGCGAGGTAAGCGAGGTGGATACTAGCAACTAATGTCTATTATAGTGCATGCATTGAATATGTATGTTGTGTGCAAGCCGATGTGTGCAAGCCGATAGAACGTATATTATGATGCCAAGAGTCAGTCCCACGGAGTCAGTCCCACGTAAAAAATCTAGTTGTGGTTTCATATAAGGTAGTCAAGATAGCCAAGTGACTCCCGTCAAAGTAAACCACTAGTCAGCGAACTTGTGTCAGCGAACTTGTACGAACACGTAGCAAGCAAATTGTCCTTTGTTTAAG

Full Affymetrix probeset data:

Annotations for 1623277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720