Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623281_s_at:

>probe:Drosophila_2:1623281_s_at:48:357; Interrogation_Position=141; Antisense; GCAAAAGGAAGGAGAGCTATGCCAT
>probe:Drosophila_2:1623281_s_at:200:79; Interrogation_Position=189; Antisense; AGGTCCATCCTGACACCGGAATTTC
>probe:Drosophila_2:1623281_s_at:689:47; Interrogation_Position=195; Antisense; ATCCTGACACCGGAATTTCGTCGAA
>probe:Drosophila_2:1623281_s_at:37:375; Interrogation_Position=200; Antisense; GACACCGGAATTTCGTCGAAGGCGA
>probe:Drosophila_2:1623281_s_at:543:363; Interrogation_Position=207; Antisense; GAATTTCGTCGAAGGCGATGAGCAT
>probe:Drosophila_2:1623281_s_at:585:115; Interrogation_Position=227; Antisense; AGCATAATGAACAGCTTTGTAAATG
>probe:Drosophila_2:1623281_s_at:711:155; Interrogation_Position=237; Antisense; ACAGCTTTGTAAATGATATTTTCGA
>probe:Drosophila_2:1623281_s_at:701:21; Interrogation_Position=252; Antisense; ATATTTTCGAGCGAATTGCTGCCGA
>probe:Drosophila_2:1623281_s_at:564:293; Interrogation_Position=259; Antisense; CGAGCGAATTGCTGCCGAAGCGTCT
>probe:Drosophila_2:1623281_s_at:579:497; Interrogation_Position=285; Antisense; GTCTAGCTCACTACAACAAGCGCTC
>probe:Drosophila_2:1623281_s_at:61:677; Interrogation_Position=288; Antisense; TAGCTCACTACAACAAGCGCTCGAC
>probe:Drosophila_2:1623281_s_at:571:123; Interrogation_Position=303; Antisense; AGCGCTCGACCATCACCAGTCGGGA
>probe:Drosophila_2:1623281_s_at:52:117; Interrogation_Position=82; Antisense; AGCCAAGAAGGCTGGCAAGGCTCAG
>probe:Drosophila_2:1623281_s_at:421:371; Interrogation_Position=88; Antisense; GAAGGCTGGCAAGGCTCAGAAGAAC

Paste this into a BLAST search page for me
GCAAAAGGAAGGAGAGCTATGCCATAGGTCCATCCTGACACCGGAATTTCATCCTGACACCGGAATTTCGTCGAAGACACCGGAATTTCGTCGAAGGCGAGAATTTCGTCGAAGGCGATGAGCATAGCATAATGAACAGCTTTGTAAATGACAGCTTTGTAAATGATATTTTCGAATATTTTCGAGCGAATTGCTGCCGACGAGCGAATTGCTGCCGAAGCGTCTGTCTAGCTCACTACAACAAGCGCTCTAGCTCACTACAACAAGCGCTCGACAGCGCTCGACCATCACCAGTCGGGAAGCCAAGAAGGCTGGCAAGGCTCAGGAAGGCTGGCAAGGCTCAGAAGAAC

Full Affymetrix probeset data:

Annotations for 1623281_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime