FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623284_at:

>probe:Drosophila_2:1623284_at:502:455; Interrogation_Position=1105; Antisense; GATAGACCCAAGTGGCGATCGCTGC
>probe:Drosophila_2:1623284_at:250:711; Interrogation_Position=1173; Antisense; TTCAACCTCAACAATGGCCATGCTG
>probe:Drosophila_2:1623284_at:6:667; Interrogation_Position=1216; Antisense; TACTTTGTGGGCACGAACTTCTTCG
>probe:Drosophila_2:1623284_at:661:79; Interrogation_Position=1271; Antisense; AGGTGTCCTGTATCAGTTTGTTGCT
>probe:Drosophila_2:1623284_at:151:549; Interrogation_Position=1300; Antisense; GGAGTAGCCTCTATTCTGATACCCA
>probe:Drosophila_2:1623284_at:304:85; Interrogation_Position=1324; Antisense; AGTGCTACAACGGTGGCCCAACTAT
>probe:Drosophila_2:1623284_at:661:305; Interrogation_Position=1356; Antisense; CCATTTTGCCTTGGGACTGGGTATT
>probe:Drosophila_2:1623284_at:686:479; Interrogation_Position=1376; Antisense; GTATTGGAGTAATCGATGCCGCATT
>probe:Drosophila_2:1623284_at:657:645; Interrogation_Position=1409; Antisense; TCTTGGCCACCTTTGTGGATGCAAC
>probe:Drosophila_2:1623284_at:117:561; Interrogation_Position=1483; Antisense; GGAACAGTCTATGCTATCCAGCAGA
>probe:Drosophila_2:1623284_at:689:495; Interrogation_Position=1513; Antisense; GTCAGTCTGGCTTATTGCTTAGCTC
>probe:Drosophila_2:1623284_at:260:89; Interrogation_Position=1553; Antisense; AGTTGGCCCAGACCTTTGGATTTGC
>probe:Drosophila_2:1623284_at:559:19; Interrogation_Position=1572; Antisense; ATTTGCTTGGCTGATGCGCATTGTC
>probe:Drosophila_2:1623284_at:427:577; Interrogation_Position=1618; Antisense; GGCCCAATATTGGTCTACTTGCATC

Paste this into a BLAST search page for me
GATAGACCCAAGTGGCGATCGCTGCTTCAACCTCAACAATGGCCATGCTGTACTTTGTGGGCACGAACTTCTTCGAGGTGTCCTGTATCAGTTTGTTGCTGGAGTAGCCTCTATTCTGATACCCAAGTGCTACAACGGTGGCCCAACTATCCATTTTGCCTTGGGACTGGGTATTGTATTGGAGTAATCGATGCCGCATTTCTTGGCCACCTTTGTGGATGCAACGGAACAGTCTATGCTATCCAGCAGAGTCAGTCTGGCTTATTGCTTAGCTCAGTTGGCCCAGACCTTTGGATTTGCATTTGCTTGGCTGATGCGCATTGTCGGCCCAATATTGGTCTACTTGCATC

Full Affymetrix probeset data:

Annotations for 1623284_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720