Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623285_at:

>probe:Drosophila_2:1623285_at:550:585; Interrogation_Position=1201; Antisense; TGGAGACGTACATTCGCCAGGGTCT
>probe:Drosophila_2:1623285_at:482:603; Interrogation_Position=1258; Antisense; TGTTCTACAAGCACGGCGTCGACGT
>probe:Drosophila_2:1623285_at:386:291; Interrogation_Position=1274; Antisense; CGTCGACGTGGAGATCTTTGCGCAT
>probe:Drosophila_2:1623285_at:89:453; Interrogation_Position=1286; Antisense; GATCTTTGCGCATGAACACTTCTAC
>probe:Drosophila_2:1623285_at:623:593; Interrogation_Position=1318; Antisense; TGTGGCCAATCTACGACTACAAGGT
>probe:Drosophila_2:1623285_at:442:161; Interrogation_Position=1336; Antisense; ACAAGGTGTACAATGGCAGTGCCGA
>probe:Drosophila_2:1623285_at:293:439; Interrogation_Position=1359; Antisense; GAGGCGCCATACACTAATCCCAAGG
>probe:Drosophila_2:1623285_at:504:137; Interrogation_Position=1444; Antisense; ACGATTTGCCCATCTGGAATGCCTA
>probe:Drosophila_2:1623285_at:158:545; Interrogation_Position=1485; Antisense; GGATACACCCGCTTGAAGGCACATA
>probe:Drosophila_2:1623285_at:540:371; Interrogation_Position=1499; Antisense; GAAGGCACATAATGGCACGCATCTT
>probe:Drosophila_2:1623285_at:424:135; Interrogation_Position=1515; Antisense; ACGCATCTTCACTTCGAGCAGGTGT
>probe:Drosophila_2:1623285_at:362:503; Interrogation_Position=1538; Antisense; GTCCGATGACCAGAACGGCGCCATT
>probe:Drosophila_2:1623285_at:586:593; Interrogation_Position=1562; Antisense; TGTCGACTCCTTCTGGGTGATCAAG
>probe:Drosophila_2:1623285_at:656:683; Interrogation_Position=1602; Antisense; TATCCATCGCCCCAATGAGATTACA

Paste this into a BLAST search page for me
TGGAGACGTACATTCGCCAGGGTCTTGTTCTACAAGCACGGCGTCGACGTCGTCGACGTGGAGATCTTTGCGCATGATCTTTGCGCATGAACACTTCTACTGTGGCCAATCTACGACTACAAGGTACAAGGTGTACAATGGCAGTGCCGAGAGGCGCCATACACTAATCCCAAGGACGATTTGCCCATCTGGAATGCCTAGGATACACCCGCTTGAAGGCACATAGAAGGCACATAATGGCACGCATCTTACGCATCTTCACTTCGAGCAGGTGTGTCCGATGACCAGAACGGCGCCATTTGTCGACTCCTTCTGGGTGATCAAGTATCCATCGCCCCAATGAGATTACA

Full Affymetrix probeset data:

Annotations for 1623285_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime