FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623286_at:

>probe:Drosophila_2:1623286_at:684:133; Interrogation_Position=153; Antisense; ACCCACCTCGGATGCATAATCTTGG
>probe:Drosophila_2:1623286_at:422:455; Interrogation_Position=184; Antisense; GATACGTTTACTGGTGCATTCGCAA
>probe:Drosophila_2:1623286_at:221:535; Interrogation_Position=196; Antisense; GGTGCATTCGCAATCCTTTGAAAAG
>probe:Drosophila_2:1623286_at:448:227; Interrogation_Position=218; Antisense; AAGGCCTACAGTACTGCAGCACCAT
>probe:Drosophila_2:1623286_at:665:111; Interrogation_Position=235; Antisense; AGCACCATTTCTTTTCGCCAGTTTG
>probe:Drosophila_2:1623286_at:231:543; Interrogation_Position=295; Antisense; GGATTACCATGTTCATCGATCGCAC
>probe:Drosophila_2:1623286_at:594:355; Interrogation_Position=316; Antisense; GCACATTCCATTGCCCATCTATATA
>probe:Drosophila_2:1623286_at:126:107; Interrogation_Position=341; Antisense; AGACAGACCTACTATCAAGCCAAAG
>probe:Drosophila_2:1623286_at:204:149; Interrogation_Position=373; Antisense; ACTTTTCATTATCATGGCCGGCACA
>probe:Drosophila_2:1623286_at:506:575; Interrogation_Position=388; Antisense; GGCCGGCACATATACCGTTTTCAGA
>probe:Drosophila_2:1623286_at:53:135; Interrogation_Position=414; Antisense; ACGCCAGTCGCTTGCGTTTGATGAA
>probe:Drosophila_2:1623286_at:558:575; Interrogation_Position=451; Antisense; GGCGAAGTCTTCTTGAAAGCCTTCA
>probe:Drosophila_2:1623286_at:108:725; Interrogation_Position=488; Antisense; TTGGATGTCCAAGAACCAGCGTCTT
>probe:Drosophila_2:1623286_at:503:175; Interrogation_Position=49; Antisense; AAACCTTTCCAAGATGGGCATCCAA

Paste this into a BLAST search page for me
ACCCACCTCGGATGCATAATCTTGGGATACGTTTACTGGTGCATTCGCAAGGTGCATTCGCAATCCTTTGAAAAGAAGGCCTACAGTACTGCAGCACCATAGCACCATTTCTTTTCGCCAGTTTGGGATTACCATGTTCATCGATCGCACGCACATTCCATTGCCCATCTATATAAGACAGACCTACTATCAAGCCAAAGACTTTTCATTATCATGGCCGGCACAGGCCGGCACATATACCGTTTTCAGAACGCCAGTCGCTTGCGTTTGATGAAGGCGAAGTCTTCTTGAAAGCCTTCATTGGATGTCCAAGAACCAGCGTCTTAAACCTTTCCAAGATGGGCATCCAA

Full Affymetrix probeset data:

Annotations for 1623286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720