FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623287_at:

>probe:Drosophila_2:1623287_at:210:423; Interrogation_Position=4280; Antisense; GAGACCCCGATGACCAGGAGGTATT
>probe:Drosophila_2:1623287_at:165:77; Interrogation_Position=4298; Antisense; AGGTATTCGTCTAGCAGCGGTTTCA
>probe:Drosophila_2:1623287_at:241:79; Interrogation_Position=4341; Antisense; AGGATATTCTCTGTGGATCTGCTCG
>probe:Drosophila_2:1623287_at:711:151; Interrogation_Position=4388; Antisense; ACATCCGACTTCTTCTATATCATAC
>probe:Drosophila_2:1623287_at:115:117; Interrogation_Position=4418; Antisense; AGCATCATTCGTACATCCAGGACAG
>probe:Drosophila_2:1623287_at:206:35; Interrogation_Position=4458; Antisense; ATCACTGCCTGTAGAACCACCTTTG
>probe:Drosophila_2:1623287_at:17:311; Interrogation_Position=4474; Antisense; CCACCTTTGGTTTAGAATCGTCGCA
>probe:Drosophila_2:1623287_at:695:109; Interrogation_Position=4487; Antisense; AGAATCGTCGCACTTGTAATGTTTG
>probe:Drosophila_2:1623287_at:284:491; Interrogation_Position=4502; Antisense; GTAATGTTTGCCATCCAAGAACGGA
>probe:Drosophila_2:1623287_at:558:15; Interrogation_Position=4537; Antisense; ATTATATGTATGTCCTATCTCCCCA
>probe:Drosophila_2:1623287_at:528:683; Interrogation_Position=4552; Antisense; TATCTCCCCAACTATCGAAAGTCCT
>probe:Drosophila_2:1623287_at:624:523; Interrogation_Position=4579; Antisense; GGGCTGCAAACCTTGCTTTAACTAC
>probe:Drosophila_2:1623287_at:21:277; Interrogation_Position=4603; Antisense; CTTTACGCGTATCCTTTGCATAGTT
>probe:Drosophila_2:1623287_at:53:25; Interrogation_Position=4748; Antisense; ATAGTTGCGTATACACACACCCATA

Paste this into a BLAST search page for me
GAGACCCCGATGACCAGGAGGTATTAGGTATTCGTCTAGCAGCGGTTTCAAGGATATTCTCTGTGGATCTGCTCGACATCCGACTTCTTCTATATCATACAGCATCATTCGTACATCCAGGACAGATCACTGCCTGTAGAACCACCTTTGCCACCTTTGGTTTAGAATCGTCGCAAGAATCGTCGCACTTGTAATGTTTGGTAATGTTTGCCATCCAAGAACGGAATTATATGTATGTCCTATCTCCCCATATCTCCCCAACTATCGAAAGTCCTGGGCTGCAAACCTTGCTTTAACTACCTTTACGCGTATCCTTTGCATAGTTATAGTTGCGTATACACACACCCATA

Full Affymetrix probeset data:

Annotations for 1623287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720