FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623288_at:

>probe:Drosophila_2:1623288_at:8:291; Interrogation_Position=370; Antisense; CGGATCGATTAAGGTGCGCATGCAG
>probe:Drosophila_2:1623288_at:44:617; Interrogation_Position=390; Antisense; TGCAGAGCTACGAGCATACCCATCT
>probe:Drosophila_2:1623288_at:227:341; Interrogation_Position=474; Antisense; GCTTCTTCCCGTACTACGTGTCGAA
>probe:Drosophila_2:1623288_at:301:669; Interrogation_Position=488; Antisense; TACGTGTCGAACATTCTGGCTGGAA
>probe:Drosophila_2:1623288_at:24:81; Interrogation_Position=522; Antisense; AGGGCAAGGGCGTCGTCTACTCCTA
>probe:Drosophila_2:1623288_at:540:449; Interrogation_Position=548; Antisense; GATCCCATCGGTCACTGCGAGAAGG
>probe:Drosophila_2:1623288_at:90:111; Interrogation_Position=567; Antisense; AGAAGGCTACATACCGCGCCGGCGG
>probe:Drosophila_2:1623288_at:355:331; Interrogation_Position=607; Antisense; GCTGCAACCGGTGCTGGACAACCAG
>probe:Drosophila_2:1623288_at:600:375; Interrogation_Position=656; Antisense; GAAGACGCCGACAAGATCAAGTTAA
>probe:Drosophila_2:1623288_at:587:651; Interrogation_Position=672; Antisense; TCAAGTTAACCAAGGAGCGGGCCGT
>probe:Drosophila_2:1623288_at:458:325; Interrogation_Position=750; Antisense; GCGACTCTGTGCTGATCAACATCAT
>probe:Drosophila_2:1623288_at:403:367; Interrogation_Position=791; Antisense; GAAGTACGAACTCTGACGCTGCGTC
>probe:Drosophila_2:1623288_at:42:441; Interrogation_Position=835; Antisense; GATGTTGCCGTTTCTTTTGGTTAGG
>probe:Drosophila_2:1623288_at:680:623; Interrogation_Position=865; Antisense; TCGGTGGAAACCAGGCATTCTAAGT

Paste this into a BLAST search page for me
CGGATCGATTAAGGTGCGCATGCAGTGCAGAGCTACGAGCATACCCATCTGCTTCTTCCCGTACTACGTGTCGAATACGTGTCGAACATTCTGGCTGGAAAGGGCAAGGGCGTCGTCTACTCCTAGATCCCATCGGTCACTGCGAGAAGGAGAAGGCTACATACCGCGCCGGCGGGCTGCAACCGGTGCTGGACAACCAGGAAGACGCCGACAAGATCAAGTTAATCAAGTTAACCAAGGAGCGGGCCGTGCGACTCTGTGCTGATCAACATCATGAAGTACGAACTCTGACGCTGCGTCGATGTTGCCGTTTCTTTTGGTTAGGTCGGTGGAAACCAGGCATTCTAAGT

Full Affymetrix probeset data:

Annotations for 1623288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720