FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623289_at:

>probe:Drosophila_2:1623289_at:61:1; Interrogation_Position=161; Antisense; AACGGTATTCATCTTGGACGCGGGA
>probe:Drosophila_2:1623289_at:69:437; Interrogation_Position=184; Antisense; GAGGAGGTACCTTGCCTGATGCGCT
>probe:Drosophila_2:1623289_at:430:285; Interrogation_Position=199; Antisense; CTGATGCGCTGCTTGGCCAGAGAAA
>probe:Drosophila_2:1623289_at:24:195; Interrogation_Position=266; Antisense; AACTGACTGAGGACCTGGGCGCCGA
>probe:Drosophila_2:1623289_at:58:595; Interrogation_Position=281; Antisense; TGGGCGCCGATGTCTATAACTACTG
>probe:Drosophila_2:1623289_at:694:667; Interrogation_Position=301; Antisense; TACTGCAGATTCGAGCTGCGCCGGA
>probe:Drosophila_2:1623289_at:645:127; Interrogation_Position=442; Antisense; ACCAACGTGGAGCTGCTGCAGTACA
>probe:Drosophila_2:1623289_at:156:83; Interrogation_Position=476; Antisense; AGTCAAAGGAACCTATTCCCTGCCT
>probe:Drosophila_2:1623289_at:519:627; Interrogation_Position=496; Antisense; TGCCTCTTTCAGTGCTTTGCGGATG
>probe:Drosophila_2:1623289_at:246:721; Interrogation_Position=512; Antisense; TTGCGGATGCCATGGGATTCTACGA
>probe:Drosophila_2:1623289_at:613:231; Interrogation_Position=592; Antisense; AATGAGGATCAGTCTTCTGGCGCTG
>probe:Drosophila_2:1623289_at:206:641; Interrogation_Position=607; Antisense; TCTGGCGCTGACTACAGTGGCTGTC
>probe:Drosophila_2:1623289_at:12:523; Interrogation_Position=623; Antisense; GTGGCTGTCGACTAAGTGGGACTCA
>probe:Drosophila_2:1623289_at:338:209; Interrogation_Position=663; Antisense; AAGCAAGTGCTCGTGGATGTACCAT

Paste this into a BLAST search page for me
AACGGTATTCATCTTGGACGCGGGAGAGGAGGTACCTTGCCTGATGCGCTCTGATGCGCTGCTTGGCCAGAGAAAAACTGACTGAGGACCTGGGCGCCGATGGGCGCCGATGTCTATAACTACTGTACTGCAGATTCGAGCTGCGCCGGAACCAACGTGGAGCTGCTGCAGTACAAGTCAAAGGAACCTATTCCCTGCCTTGCCTCTTTCAGTGCTTTGCGGATGTTGCGGATGCCATGGGATTCTACGAAATGAGGATCAGTCTTCTGGCGCTGTCTGGCGCTGACTACAGTGGCTGTCGTGGCTGTCGACTAAGTGGGACTCAAAGCAAGTGCTCGTGGATGTACCAT

Full Affymetrix probeset data:

Annotations for 1623289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720