FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623290_at:

>probe:Drosophila_2:1623290_at:603:23; Interrogation_Position=1032; Antisense; ATATCGCCGGAAATGTACCCGTCAT
>probe:Drosophila_2:1623290_at:337:305; Interrogation_Position=1105; Antisense; CCGGACATCCGGGACTGGAGAGTCT
>probe:Drosophila_2:1623290_at:318:81; Interrogation_Position=1159; Antisense; AGGTGTCCAGCGACGGCAGCAATAA
>probe:Drosophila_2:1623290_at:163:605; Interrogation_Position=1285; Antisense; TGATCTACAACTACGTGCAACCACA
>probe:Drosophila_2:1623290_at:499:489; Interrogation_Position=1316; Antisense; GTACTACCGCTCCTGAGGCGAGAAT
>probe:Drosophila_2:1623290_at:414:243; Interrogation_Position=1346; Antisense; AATTAGCAGCTACCAAAGACCCTTG
>probe:Drosophila_2:1623290_at:63:77; Interrogation_Position=1376; Antisense; AGGAGGTTGCTCTGCTGCCATAGGA
>probe:Drosophila_2:1623290_at:3:243; Interrogation_Position=1405; Antisense; AATAGCGGACACGTTGCATCGGAAA
>probe:Drosophila_2:1623290_at:164:327; Interrogation_Position=1439; Antisense; GCGAGCTGGCGTATTGTTATTATTT
>probe:Drosophila_2:1623290_at:536:659; Interrogation_Position=1477; Antisense; TAACTTAGTTAAACCTGGCGCACAC
>probe:Drosophila_2:1623290_at:617:581; Interrogation_Position=1492; Antisense; TGGCGCACACATTTAGTCTAGTTCT
>probe:Drosophila_2:1623290_at:138:89; Interrogation_Position=1506; Antisense; AGTCTAGTTCTTGTCTCTGTAATTA
>probe:Drosophila_2:1623290_at:685:171; Interrogation_Position=953; Antisense; AAAGATGATGTACCAGTTCCCGGAA
>probe:Drosophila_2:1623290_at:267:189; Interrogation_Position=976; Antisense; AACAGACGCCGTACATGATGCCGTA

Paste this into a BLAST search page for me
ATATCGCCGGAAATGTACCCGTCATCCGGACATCCGGGACTGGAGAGTCTAGGTGTCCAGCGACGGCAGCAATAATGATCTACAACTACGTGCAACCACAGTACTACCGCTCCTGAGGCGAGAATAATTAGCAGCTACCAAAGACCCTTGAGGAGGTTGCTCTGCTGCCATAGGAAATAGCGGACACGTTGCATCGGAAAGCGAGCTGGCGTATTGTTATTATTTTAACTTAGTTAAACCTGGCGCACACTGGCGCACACATTTAGTCTAGTTCTAGTCTAGTTCTTGTCTCTGTAATTAAAAGATGATGTACCAGTTCCCGGAAAACAGACGCCGTACATGATGCCGTA

Full Affymetrix probeset data:

Annotations for 1623290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720