Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623291_at:

>probe:Drosophila_2:1623291_at:11:391; Interrogation_Position=1017; Antisense; GAAACTTTACCTGTATCCTACTCGG
>probe:Drosophila_2:1623291_at:6:331; Interrogation_Position=497; Antisense; GCGGTATTAGTCAGGCCATCGCCAA
>probe:Drosophila_2:1623291_at:260:581; Interrogation_Position=542; Antisense; TGGCCAAGATCATCTACCATACTCG
>probe:Drosophila_2:1623291_at:225:225; Interrogation_Position=595; Antisense; AAGGCAGAGCATGTGTCGTTTGAAC
>probe:Drosophila_2:1623291_at:128:219; Interrogation_Position=633; Antisense; AAGTGACTTCCTGGTGGTAGCTGCT
>probe:Drosophila_2:1623291_at:293:487; Interrogation_Position=649; Antisense; GTAGCTGCTCCACTTACAAACGAAA
>probe:Drosophila_2:1623291_at:251:93; Interrogation_Position=718; Antisense; AGTTCTGTGTTTGTCAATGTGGCCA
>probe:Drosophila_2:1623291_at:111:277; Interrogation_Position=769; Antisense; CTTCATGACGCCCTGACAAATGGTA
>probe:Drosophila_2:1623291_at:489:229; Interrogation_Position=787; Antisense; AATGGTACAATTTCTGCCGCAGGCT
>probe:Drosophila_2:1623291_at:441:625; Interrogation_Position=801; Antisense; TGCCGCAGGCTTGGATGTGACCACA
>probe:Drosophila_2:1623291_at:591:241; Interrogation_Position=844; Antisense; AATAGTCCTCTTCTCAATGTGCCCA
>probe:Drosophila_2:1623291_at:389:61; Interrogation_Position=860; Antisense; ATGTGCCCAATTGTGTTATCCTTCC
>probe:Drosophila_2:1623291_at:201:395; Interrogation_Position=919; Antisense; GAAATGGGATTGCTTGCTGCCAATA
>probe:Drosophila_2:1623291_at:567:613; Interrogation_Position=950; Antisense; TGAACGCCATCGAAGGGAAGCCCAT

Paste this into a BLAST search page for me
GAAACTTTACCTGTATCCTACTCGGGCGGTATTAGTCAGGCCATCGCCAATGGCCAAGATCATCTACCATACTCGAAGGCAGAGCATGTGTCGTTTGAACAAGTGACTTCCTGGTGGTAGCTGCTGTAGCTGCTCCACTTACAAACGAAAAGTTCTGTGTTTGTCAATGTGGCCACTTCATGACGCCCTGACAAATGGTAAATGGTACAATTTCTGCCGCAGGCTTGCCGCAGGCTTGGATGTGACCACAAATAGTCCTCTTCTCAATGTGCCCAATGTGCCCAATTGTGTTATCCTTCCGAAATGGGATTGCTTGCTGCCAATATGAACGCCATCGAAGGGAAGCCCAT

Full Affymetrix probeset data:

Annotations for 1623291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime