Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623292_at:

>probe:Drosophila_2:1623292_at:695:157; Interrogation_Position=1006; Antisense; ACAACCTGATTGGAGGCGTTCCCAT
>probe:Drosophila_2:1623292_at:524:327; Interrogation_Position=1021; Antisense; GCGTTCCCATCCAGGGTGATTACTA
>probe:Drosophila_2:1623292_at:269:471; Interrogation_Position=1077; Antisense; GTTCTGACCATCAACATCGGTGGCA
>probe:Drosophila_2:1623292_at:328:699; Interrogation_Position=1126; Antisense; TTTACATCCAAACCTACACCGAGGG
>probe:Drosophila_2:1623292_at:540:41; Interrogation_Position=1185; Antisense; ATCGGAACGGGCTTCTGGATCCTGG
>probe:Drosophila_2:1623292_at:162:593; Interrogation_Position=1207; Antisense; TGGGCGACGTTTTCCTGGGTCAATA
>probe:Drosophila_2:1623292_at:214:531; Interrogation_Position=1223; Antisense; GGGTCAATACTACTCCGAATTCGAT
>probe:Drosophila_2:1623292_at:399:437; Interrogation_Position=1251; Antisense; GGTCAGAACCGTGTGGGTTTCGCCA
>probe:Drosophila_2:1623292_at:572:633; Interrogation_Position=1270; Antisense; TCGCCACTCTGGCTTAGAGCTTTAA
>probe:Drosophila_2:1623292_at:288:401; Interrogation_Position=1308; Antisense; GACATGCTTTCTAGGTTAACTCTGC
>probe:Drosophila_2:1623292_at:97:641; Interrogation_Position=789; Antisense; TCTGCCGTGGATGGTGGCCAACTGA
>probe:Drosophila_2:1623292_at:151:547; Interrogation_Position=817; Antisense; TGGGTGGAACCGACCAGAACCTCAT
>probe:Drosophila_2:1623292_at:627:127; Interrogation_Position=835; Antisense; ACCTCATCGCCGGTGAAATGACCTA
>probe:Drosophila_2:1623292_at:285:229; Interrogation_Position=915; Antisense; AATGGAACCGTGATCTCCAGCGGAT

Paste this into a BLAST search page for me
ACAACCTGATTGGAGGCGTTCCCATGCGTTCCCATCCAGGGTGATTACTAGTTCTGACCATCAACATCGGTGGCATTTACATCCAAACCTACACCGAGGGATCGGAACGGGCTTCTGGATCCTGGTGGGCGACGTTTTCCTGGGTCAATAGGGTCAATACTACTCCGAATTCGATGGTCAGAACCGTGTGGGTTTCGCCATCGCCACTCTGGCTTAGAGCTTTAAGACATGCTTTCTAGGTTAACTCTGCTCTGCCGTGGATGGTGGCCAACTGATGGGTGGAACCGACCAGAACCTCATACCTCATCGCCGGTGAAATGACCTAAATGGAACCGTGATCTCCAGCGGAT

Full Affymetrix probeset data:

Annotations for 1623292_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime