FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623293_at:

>probe:Drosophila_2:1623293_at:473:51; Interrogation_Position=418; Antisense; ATGCAGCAGTTTGTCCCGGAAAGGC
>probe:Drosophila_2:1623293_at:390:567; Interrogation_Position=440; Antisense; GGCACAAGATTCTGGGCGCCGAATT
>probe:Drosophila_2:1623293_at:304:573; Interrogation_Position=465; Antisense; GGCTGCGGCGCATTTCATACTGTAC
>probe:Drosophila_2:1623293_at:221:217; Interrogation_Position=505; Antisense; AAGTTCATCAACGATACCCACTGGC
>probe:Drosophila_2:1623293_at:173:523; Interrogation_Position=533; Antisense; GGGCCTCCAAAGATGGCGAGTTCAA
>probe:Drosophila_2:1623293_at:101:315; Interrogation_Position=561; Antisense; GCCTAATAAGTTTGATCCTCGCTAT
>probe:Drosophila_2:1623293_at:302:93; Interrogation_Position=665; Antisense; AGTTCCTGTCCTTTCACAATGTGAA
>probe:Drosophila_2:1623293_at:381:433; Interrogation_Position=725; Antisense; GAGGTGGCTTCCCTAACCTGGAAGT
>probe:Drosophila_2:1623293_at:112:651; Interrogation_Position=773; Antisense; TCACCAGCAATGGATTGGCCTGTCT
>probe:Drosophila_2:1623293_at:292:317; Interrogation_Position=790; Antisense; GCCTGTCTGTATCGTTTTCCTAAAC
>probe:Drosophila_2:1623293_at:688:361; Interrogation_Position=859; Antisense; GAATTGTCCACGGTCATGTTAGAGG
>probe:Drosophila_2:1623293_at:605:577; Interrogation_Position=885; Antisense; GGCCATGCCCGCTTTAAAAATTGTT
>probe:Drosophila_2:1623293_at:707:701; Interrogation_Position=898; Antisense; TTAAAAATTGTTGGCGCCGACGCTA
>probe:Drosophila_2:1623293_at:380:303; Interrogation_Position=914; Antisense; CCGACGCTATTCACAGCTAAGGCTA

Paste this into a BLAST search page for me
ATGCAGCAGTTTGTCCCGGAAAGGCGGCACAAGATTCTGGGCGCCGAATTGGCTGCGGCGCATTTCATACTGTACAAGTTCATCAACGATACCCACTGGCGGGCCTCCAAAGATGGCGAGTTCAAGCCTAATAAGTTTGATCCTCGCTATAGTTCCTGTCCTTTCACAATGTGAAGAGGTGGCTTCCCTAACCTGGAAGTTCACCAGCAATGGATTGGCCTGTCTGCCTGTCTGTATCGTTTTCCTAAACGAATTGTCCACGGTCATGTTAGAGGGGCCATGCCCGCTTTAAAAATTGTTTTAAAAATTGTTGGCGCCGACGCTACCGACGCTATTCACAGCTAAGGCTA

Full Affymetrix probeset data:

Annotations for 1623293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720