Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623294_at:

>probe:Drosophila_2:1623294_at:204:335; Interrogation_Position=1132; Antisense; GCTGCTGGGCAAGCGGCTTACGATA
>probe:Drosophila_2:1623294_at:569:707; Interrogation_Position=1149; Antisense; TTACGATAAGCCATGGATCCACGTG
>probe:Drosophila_2:1623294_at:583:623; Interrogation_Position=1172; Antisense; TGCCCGGAGTAACAGTGCACTTTGT
>probe:Drosophila_2:1623294_at:113:617; Interrogation_Position=1187; Antisense; TGCACTTTGTGTCGCCCATGGAGAT
>probe:Drosophila_2:1623294_at:203:223; Interrogation_Position=1225; Antisense; AAGGGTGCAGCTCATTGGAACAATA
>probe:Drosophila_2:1623294_at:370:577; Interrogation_Position=1269; Antisense; GGCCTATAACTATTACTCTTTCTTG
>probe:Drosophila_2:1623294_at:334:223; Interrogation_Position=1297; Antisense; AAGGACTTCTTCCAGGCGATGCGTG
>probe:Drosophila_2:1623294_at:80:507; Interrogation_Position=1319; Antisense; GTGCGCAATCACTTTTTATTCTGGA
>probe:Drosophila_2:1623294_at:475:77; Interrogation_Position=1415; Antisense; AGGATGCTGGCCTTAAGGCGGCCAT
>probe:Drosophila_2:1623294_at:669:203; Interrogation_Position=1514; Antisense; AAGCCGTGACAGAAGCCATGCCAGA
>probe:Drosophila_2:1623294_at:305:591; Interrogation_Position=1572; Antisense; TGGTGAACCTGCTGAAGAGTATACT
>probe:Drosophila_2:1623294_at:264:375; Interrogation_Position=1609; Antisense; GAAGAGATTCCCTCATCGAATCAGA
>probe:Drosophila_2:1623294_at:622:295; Interrogation_Position=1625; Antisense; CGAATCAGACTGTGGCAGCCATTAA
>probe:Drosophila_2:1623294_at:128:85; Interrogation_Position=1656; Antisense; AGTGGAGGCAGAAGGTCCCCTACAA

Paste this into a BLAST search page for me
GCTGCTGGGCAAGCGGCTTACGATATTACGATAAGCCATGGATCCACGTGTGCCCGGAGTAACAGTGCACTTTGTTGCACTTTGTGTCGCCCATGGAGATAAGGGTGCAGCTCATTGGAACAATAGGCCTATAACTATTACTCTTTCTTGAAGGACTTCTTCCAGGCGATGCGTGGTGCGCAATCACTTTTTATTCTGGAAGGATGCTGGCCTTAAGGCGGCCATAAGCCGTGACAGAAGCCATGCCAGATGGTGAACCTGCTGAAGAGTATACTGAAGAGATTCCCTCATCGAATCAGACGAATCAGACTGTGGCAGCCATTAAAGTGGAGGCAGAAGGTCCCCTACAA

Full Affymetrix probeset data:

Annotations for 1623294_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime