Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623295_at:

>probe:Drosophila_2:1623295_at:109:427; Interrogation_Position=1192; Antisense; GAGAGATGTGCAAGCGCTCCTTTGA
>probe:Drosophila_2:1623295_at:392:337; Interrogation_Position=1207; Antisense; GCTCCTTTGATCTGCGACATCAGAT
>probe:Drosophila_2:1623295_at:295:723; Interrogation_Position=1231; Antisense; TTGTCCGTGAAAAGGAGCCACCACT
>probe:Drosophila_2:1623295_at:213:579; Interrogation_Position=1261; Antisense; GGCCGTCTCGTCACGAAAGCAGTAA
>probe:Drosophila_2:1623295_at:104:311; Interrogation_Position=1330; Antisense; CCAATACGGCTGGTGGCGATTTTGC
>probe:Drosophila_2:1623295_at:267:461; Interrogation_Position=1347; Antisense; GATTTTGCCAAAACCACGTCCAAGA
>probe:Drosophila_2:1623295_at:547:9; Interrogation_Position=1395; Antisense; ATTCGCGCGCAGCACGAGAACATCT
>probe:Drosophila_2:1623295_at:493:423; Interrogation_Position=1410; Antisense; GAGAACATCTTACGGCTGCAAAGGA
>probe:Drosophila_2:1623295_at:652:225; Interrogation_Position=1440; Antisense; AAGGCACGTGAAGCCCTAGATCTGC
>probe:Drosophila_2:1623295_at:252:719; Interrogation_Position=1497; Antisense; TTCCCGCGACAAATGGAGCCTCAGT
>probe:Drosophila_2:1623295_at:686:553; Interrogation_Position=1511; Antisense; GGAGCCTCAGTATCCACCGATAAAA
>probe:Drosophila_2:1623295_at:115:589; Interrogation_Position=1568; Antisense; TGGAGATGGCGCGATTCTGACCAGC
>probe:Drosophila_2:1623295_at:455:173; Interrogation_Position=1599; Antisense; AAACCTACCATTTCTTCGCCAGTGT
>probe:Drosophila_2:1623295_at:328:503; Interrogation_Position=1622; Antisense; GTCGCTGGTGCTCCTATAAGCTTAG

Paste this into a BLAST search page for me
GAGAGATGTGCAAGCGCTCCTTTGAGCTCCTTTGATCTGCGACATCAGATTTGTCCGTGAAAAGGAGCCACCACTGGCCGTCTCGTCACGAAAGCAGTAACCAATACGGCTGGTGGCGATTTTGCGATTTTGCCAAAACCACGTCCAAGAATTCGCGCGCAGCACGAGAACATCTGAGAACATCTTACGGCTGCAAAGGAAAGGCACGTGAAGCCCTAGATCTGCTTCCCGCGACAAATGGAGCCTCAGTGGAGCCTCAGTATCCACCGATAAAATGGAGATGGCGCGATTCTGACCAGCAAACCTACCATTTCTTCGCCAGTGTGTCGCTGGTGCTCCTATAAGCTTAG

Full Affymetrix probeset data:

Annotations for 1623295_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime