FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623296_at:

>probe:Drosophila_2:1623296_at:205:655; Interrogation_Position=117; Antisense; TAATGCTGTTTAAAATGCCCTACCA
>probe:Drosophila_2:1623296_at:55:309; Interrogation_Position=139; Antisense; CCATTTGCCGCTTTGTGCCAAGAAA
>probe:Drosophila_2:1623296_at:83:411; Interrogation_Position=173; Antisense; GACGAATTAGCTCGCTGTCCATATA
>probe:Drosophila_2:1623296_at:34:155; Interrogation_Position=198; Antisense; ACAGAACCCATATGTACCCTATTGC
>probe:Drosophila_2:1623296_at:552:385; Interrogation_Position=233; Antisense; GAACATATCATCAAGTGCCCGAGCT
>probe:Drosophila_2:1623296_at:658:319; Interrogation_Position=249; Antisense; GCCCGAGCTACTTACGCGAGGAGAG
>probe:Drosophila_2:1623296_at:462:437; Interrogation_Position=266; Antisense; GAGGAGAGCCACAGCGACGCAAAAG
>probe:Drosophila_2:1623296_at:284:445; Interrogation_Position=323; Antisense; GATGCCAAGGACTGGGATGCCGACC
>probe:Drosophila_2:1623296_at:156:411; Interrogation_Position=344; Antisense; GACCCGCCGGTTTCGACATATGATC
>probe:Drosophila_2:1623296_at:97:683; Interrogation_Position=362; Antisense; TATGATCCGAATATCCACTGTGAGA
>probe:Drosophila_2:1623296_at:261:105; Interrogation_Position=384; Antisense; AGAAGAACCCTATCATTCGTCGTCT
>probe:Drosophila_2:1623296_at:273:499; Interrogation_Position=58; Antisense; GTCTGCGGATCCAAAACTTTATGAA
>probe:Drosophila_2:1623296_at:77:365; Interrogation_Position=80; Antisense; GAATATGTCAATTGTCCCAACTCTA
>probe:Drosophila_2:1623296_at:485:299; Interrogation_Position=95; Antisense; CCCAACTCTAGCTCGCATTTGGTAA

Paste this into a BLAST search page for me
TAATGCTGTTTAAAATGCCCTACCACCATTTGCCGCTTTGTGCCAAGAAAGACGAATTAGCTCGCTGTCCATATAACAGAACCCATATGTACCCTATTGCGAACATATCATCAAGTGCCCGAGCTGCCCGAGCTACTTACGCGAGGAGAGGAGGAGAGCCACAGCGACGCAAAAGGATGCCAAGGACTGGGATGCCGACCGACCCGCCGGTTTCGACATATGATCTATGATCCGAATATCCACTGTGAGAAGAAGAACCCTATCATTCGTCGTCTGTCTGCGGATCCAAAACTTTATGAAGAATATGTCAATTGTCCCAACTCTACCCAACTCTAGCTCGCATTTGGTAA

Full Affymetrix probeset data:

Annotations for 1623296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720