FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623297_at:

>probe:Drosophila_2:1623297_at:570:53; Interrogation_Position=132; Antisense; ATGCAGCCAGCGGAACAGATCTTCT
>probe:Drosophila_2:1623297_at:729:95; Interrogation_Position=148; Antisense; AGATCTTCTCCTGCGGATTCGAACT
>probe:Drosophila_2:1623297_at:697:463; Interrogation_Position=163; Antisense; GATTCGAACTCTTCGGGCGAGTACA
>probe:Drosophila_2:1623297_at:649:397; Interrogation_Position=209; Antisense; GACACGAGATCTGGCCACAATGAAC
>probe:Drosophila_2:1623297_at:87:527; Interrogation_Position=290; Antisense; GGGCACACTGCCCAAGGTCAACGTG
>probe:Drosophila_2:1623297_at:712:537; Interrogation_Position=305; Antisense; GGTCAACGTGCTGAAGTTCTGGCTA
>probe:Drosophila_2:1623297_at:144:217; Interrogation_Position=318; Antisense; AAGTTCTGGCTACTGAATATCGGCA
>probe:Drosophila_2:1623297_at:715:241; Interrogation_Position=333; Antisense; AATATCGGCAGTCCGCGCTCGATTA
>probe:Drosophila_2:1623297_at:394:279; Interrogation_Position=350; Antisense; CTCGATTATCGAGCGGGCGGAATTC
>probe:Drosophila_2:1623297_at:277:71; Interrogation_Position=385; Antisense; AGGAGATCACTTCGCACAACTTTAG
>probe:Drosophila_2:1623297_at:249:191; Interrogation_Position=402; Antisense; AACTTTAGCCGATTCTCGATTCGCT
>probe:Drosophila_2:1623297_at:568:715; Interrogation_Position=414; Antisense; TTCTCGATTCGCTACCACAATGTGG
>probe:Drosophila_2:1623297_at:89:187; Interrogation_Position=46; Antisense; AACAAGTGGAGTTTCTGTTTCTATC
>probe:Drosophila_2:1623297_at:442:281; Interrogation_Position=70; Antisense; CTCTCTCTCGATCGACAATAAGTTG

Paste this into a BLAST search page for me
ATGCAGCCAGCGGAACAGATCTTCTAGATCTTCTCCTGCGGATTCGAACTGATTCGAACTCTTCGGGCGAGTACAGACACGAGATCTGGCCACAATGAACGGGCACACTGCCCAAGGTCAACGTGGGTCAACGTGCTGAAGTTCTGGCTAAAGTTCTGGCTACTGAATATCGGCAAATATCGGCAGTCCGCGCTCGATTACTCGATTATCGAGCGGGCGGAATTCAGGAGATCACTTCGCACAACTTTAGAACTTTAGCCGATTCTCGATTCGCTTTCTCGATTCGCTACCACAATGTGGAACAAGTGGAGTTTCTGTTTCTATCCTCTCTCTCGATCGACAATAAGTTG

Full Affymetrix probeset data:

Annotations for 1623297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720