FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623298_at:

>probe:Drosophila_2:1623298_at:595:565; Interrogation_Position=1013; Antisense; GGCAATCAAAATAGCTCCATCTGGG
>probe:Drosophila_2:1623298_at:412:529; Interrogation_Position=1045; Antisense; GGGATTCTTGGTATTCACCGGCTAC
>probe:Drosophila_2:1623298_at:439:417; Interrogation_Position=1090; Antisense; GAGCTTTTCAACCTAAGATGCCTTG
>probe:Drosophila_2:1623298_at:590:457; Interrogation_Position=1148; Antisense; GATATCCAAGGCCTTTCAGTAGTGT
>probe:Drosophila_2:1623298_at:428:549; Interrogation_Position=1181; Antisense; GGAGTGTGATAATCTCGATCCGATC
>probe:Drosophila_2:1623298_at:549:659; Interrogation_Position=1227; Antisense; TAAGCCATATTAGCACCTGACATTT
>probe:Drosophila_2:1623298_at:460:19; Interrogation_Position=1297; Antisense; ATATATGTTAACTTTGCGTTCCCAA
>probe:Drosophila_2:1623298_at:420:235; Interrogation_Position=834; Antisense; AATCGCCAAGGATTTGTGTCCAGCC
>probe:Drosophila_2:1623298_at:222:517; Interrogation_Position=849; Antisense; GTGTCCAGCCGAAAACCAGCAACTA
>probe:Drosophila_2:1623298_at:639:359; Interrogation_Position=867; Antisense; GCAACTACATTCGTGGCCGGCTTTA
>probe:Drosophila_2:1623298_at:97:571; Interrogation_Position=885; Antisense; GGCTTTACATGGATGCCGGTGCCAC
>probe:Drosophila_2:1623298_at:39:309; Interrogation_Position=906; Antisense; CCACGCTGACGGAACGGGATCGTTT
>probe:Drosophila_2:1623298_at:305:467; Interrogation_Position=931; Antisense; GTTGGGCCTAAGAAGCATCGACGGA
>probe:Drosophila_2:1623298_at:16:415; Interrogation_Position=954; Antisense; GAGCCTTCGAGGACGTGGCTAGCCA

Paste this into a BLAST search page for me
GGCAATCAAAATAGCTCCATCTGGGGGGATTCTTGGTATTCACCGGCTACGAGCTTTTCAACCTAAGATGCCTTGGATATCCAAGGCCTTTCAGTAGTGTGGAGTGTGATAATCTCGATCCGATCTAAGCCATATTAGCACCTGACATTTATATATGTTAACTTTGCGTTCCCAAAATCGCCAAGGATTTGTGTCCAGCCGTGTCCAGCCGAAAACCAGCAACTAGCAACTACATTCGTGGCCGGCTTTAGGCTTTACATGGATGCCGGTGCCACCCACGCTGACGGAACGGGATCGTTTGTTGGGCCTAAGAAGCATCGACGGAGAGCCTTCGAGGACGTGGCTAGCCA

Full Affymetrix probeset data:

Annotations for 1623298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720