FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623299_at:

>probe:Drosophila_2:1623299_at:131:247; Interrogation_Position=4313; Antisense; AATTGTGTTCTTCATAGGTCGCGAG
>probe:Drosophila_2:1623299_at:710:11; Interrogation_Position=4346; Antisense; ATTCAACTCGGTGATGCTAGCTCCT
>probe:Drosophila_2:1623299_at:629:389; Interrogation_Position=4379; Antisense; GAAACCACTTGCCAGTCTGGGTCTG
>probe:Drosophila_2:1623299_at:25:357; Interrogation_Position=4474; Antisense; GCACACTGTACTGGCGCATCGACGA
>probe:Drosophila_2:1623299_at:151:345; Interrogation_Position=4489; Antisense; GCATCGACGACTACACGGGTCAGGT
>probe:Drosophila_2:1623299_at:303:521; Interrogation_Position=4512; Antisense; GTGGAATTGGATTACCCGCGCGACA
>probe:Drosophila_2:1623299_at:137:269; Interrogation_Position=4541; Antisense; CATCTGGTCGGGAGTGGGCTACAAT
>probe:Drosophila_2:1623299_at:267:25; Interrogation_Position=4566; Antisense; ATAGATGCGGCATTCCAGTACTTGG
>probe:Drosophila_2:1623299_at:716:591; Interrogation_Position=4626; Antisense; TGGGAGTTCAACGACGACCGCATGA
>probe:Drosophila_2:1623299_at:317:613; Interrogation_Position=4648; Antisense; TGAAGGTGGCCCATGCCAGGGCTAA
>probe:Drosophila_2:1623299_at:663:79; Interrogation_Position=4665; Antisense; AGGGCTAAGCTCTCGGCACGAAGGT
>probe:Drosophila_2:1623299_at:120:87; Interrogation_Position=4696; Antisense; AGTGCGCCCGCAGTGCTAATGAGGT
>probe:Drosophila_2:1623299_at:594:77; Interrogation_Position=4797; Antisense; AGGATCAACCACTTCATTCTTTCGA
>probe:Drosophila_2:1623299_at:146:11; Interrogation_Position=4812; Antisense; ATTCTTTCGATCCTTTTGCTAGCCA

Paste this into a BLAST search page for me
AATTGTGTTCTTCATAGGTCGCGAGATTCAACTCGGTGATGCTAGCTCCTGAAACCACTTGCCAGTCTGGGTCTGGCACACTGTACTGGCGCATCGACGAGCATCGACGACTACACGGGTCAGGTGTGGAATTGGATTACCCGCGCGACACATCTGGTCGGGAGTGGGCTACAATATAGATGCGGCATTCCAGTACTTGGTGGGAGTTCAACGACGACCGCATGATGAAGGTGGCCCATGCCAGGGCTAAAGGGCTAAGCTCTCGGCACGAAGGTAGTGCGCCCGCAGTGCTAATGAGGTAGGATCAACCACTTCATTCTTTCGAATTCTTTCGATCCTTTTGCTAGCCA

Full Affymetrix probeset data:

Annotations for 1623299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720