Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623300_at:

>probe:Drosophila_2:1623300_at:165:329; Interrogation_Position=1108; Antisense; GCGGGCAGCGTTAACTTAAATTTCG
>probe:Drosophila_2:1623300_at:109:511; Interrogation_Position=1199; Antisense; GTGAAGCTCAGGAACCCAATGTCGT
>probe:Drosophila_2:1623300_at:537:425; Interrogation_Position=1226; Antisense; GAGAGATATGCTTCCACAATAGCCA
>probe:Drosophila_2:1623300_at:66:565; Interrogation_Position=1257; Antisense; GGCTGGTTACTACAAAAATCCCGAT
>probe:Drosophila_2:1623300_at:608:163; Interrogation_Position=1272; Antisense; AAATCCCGATGAAACCAGGCAAATT
>probe:Drosophila_2:1623300_at:96:105; Interrogation_Position=1299; Antisense; AGACTCTGAGAACTGGATTCACACA
>probe:Drosophila_2:1623300_at:662:37; Interrogation_Position=1355; Antisense; ATCTATTTGTTATCGATCGCCTAAA
>probe:Drosophila_2:1623300_at:109:429; Interrogation_Position=1420; Antisense; GAGATTGAGAATGTCATCGCCGAAA
>probe:Drosophila_2:1623300_at:492:233; Interrogation_Position=1443; Antisense; AATGCCAAATGTGCTCGAGGCTTGT
>probe:Drosophila_2:1623300_at:655:515; Interrogation_Position=1466; Antisense; GTGTGTTCGGCATTTGGGATCCAGT
>probe:Drosophila_2:1623300_at:23:439; Interrogation_Position=1501; Antisense; GAGGCAGCAGCATCGTTGGTCAAGA
>probe:Drosophila_2:1623300_at:161:529; Interrogation_Position=1530; Antisense; GGGTACCCAACTGGAAGCGCAGGAT
>probe:Drosophila_2:1623300_at:173:563; Interrogation_Position=1571; Antisense; GGAAGCGCATAACTGCCAAGTTTAA
>probe:Drosophila_2:1623300_at:89:451; Interrogation_Position=1661; Antisense; GATCGGCTGTCAAAGAGCACTTTTT

Paste this into a BLAST search page for me
GCGGGCAGCGTTAACTTAAATTTCGGTGAAGCTCAGGAACCCAATGTCGTGAGAGATATGCTTCCACAATAGCCAGGCTGGTTACTACAAAAATCCCGATAAATCCCGATGAAACCAGGCAAATTAGACTCTGAGAACTGGATTCACACAATCTATTTGTTATCGATCGCCTAAAGAGATTGAGAATGTCATCGCCGAAAAATGCCAAATGTGCTCGAGGCTTGTGTGTGTTCGGCATTTGGGATCCAGTGAGGCAGCAGCATCGTTGGTCAAGAGGGTACCCAACTGGAAGCGCAGGATGGAAGCGCATAACTGCCAAGTTTAAGATCGGCTGTCAAAGAGCACTTTTT

Full Affymetrix probeset data:

Annotations for 1623300_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime