FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623302_at:

>probe:Drosophila_2:1623302_at:596:493; Interrogation_Position=549; Antisense; GTCTTTATAGCCTCCATGTTTGGTG
>probe:Drosophila_2:1623302_at:630:601; Interrogation_Position=565; Antisense; TGTTTGGTGGAGACACCCTCTACGA
>probe:Drosophila_2:1623302_at:56:359; Interrogation_Position=625; Antisense; GCAAAGGTGGCATATCTCCGCACAT
>probe:Drosophila_2:1623302_at:487:459; Interrogation_Position=672; Antisense; GATATTGGTTCCCTGCTTAATCGCG
>probe:Drosophila_2:1623302_at:312:289; Interrogation_Position=698; Antisense; CGGCTTCACCATGCTGACAATAGAC
>probe:Drosophila_2:1623302_at:488:443; Interrogation_Position=726; Antisense; GATGAACTGGTCATCGGCTATCCCA
>probe:Drosophila_2:1623302_at:649:571; Interrogation_Position=741; Antisense; GGCTATCCCAGCATGTTCGAACTGA
>probe:Drosophila_2:1623302_at:48:187; Interrogation_Position=792; Antisense; AACAATGCTGCATTCAATCGACCCG
>probe:Drosophila_2:1623302_at:660:411; Interrogation_Position=811; Antisense; GACCCGCTCATCTTAGTCGAGAAAC
>probe:Drosophila_2:1623302_at:680:423; Interrogation_Position=829; Antisense; GAGAAACGATGCTCGCGGCCAGTGC
>probe:Drosophila_2:1623302_at:574:75; Interrogation_Position=862; Antisense; AGGAGCTGTATGCAAAGCCCAACGA
>probe:Drosophila_2:1623302_at:250:615; Interrogation_Position=899; Antisense; TGCAACCTTCCAAATCATCTACTTT
>probe:Drosophila_2:1623302_at:96:249; Interrogation_Position=944; Antisense; CAATCAGCCACAGCCTCTGGAAAGA
>probe:Drosophila_2:1623302_at:540:501; Interrogation_Position=983; Antisense; GTCGCTCAAGGATCTAGGGTCGATT

Paste this into a BLAST search page for me
GTCTTTATAGCCTCCATGTTTGGTGTGTTTGGTGGAGACACCCTCTACGAGCAAAGGTGGCATATCTCCGCACATGATATTGGTTCCCTGCTTAATCGCGCGGCTTCACCATGCTGACAATAGACGATGAACTGGTCATCGGCTATCCCAGGCTATCCCAGCATGTTCGAACTGAAACAATGCTGCATTCAATCGACCCGGACCCGCTCATCTTAGTCGAGAAACGAGAAACGATGCTCGCGGCCAGTGCAGGAGCTGTATGCAAAGCCCAACGATGCAACCTTCCAAATCATCTACTTTCAATCAGCCACAGCCTCTGGAAAGAGTCGCTCAAGGATCTAGGGTCGATT

Full Affymetrix probeset data:

Annotations for 1623302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720