FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623304_at:

>probe:Drosophila_2:1623304_at:430:627; Interrogation_Position=1001; Antisense; TGCCATTGACACTGCCGCGACCGAA
>probe:Drosophila_2:1623304_at:57:413; Interrogation_Position=1019; Antisense; GACCGAATCCTGACCAACGCCACGA
>probe:Drosophila_2:1623304_at:52:415; Interrogation_Position=1042; Antisense; GACCAAATCCCACAGCAATGCCATA
>probe:Drosophila_2:1623304_at:158:153; Interrogation_Position=1053; Antisense; ACAGCAATGCCATAACTTATCCCGA
>probe:Drosophila_2:1623304_at:462:31; Interrogation_Position=1064; Antisense; ATAACTTATCCCGACCGCAGTGAGG
>probe:Drosophila_2:1623304_at:456:699; Interrogation_Position=920; Antisense; TTTATGACACCAGAACGACCCCGAA
>probe:Drosophila_2:1623304_at:79:383; Interrogation_Position=932; Antisense; GAACGACCCCGAATGCAAGATCCAG
>probe:Drosophila_2:1623304_at:40:413; Interrogation_Position=936; Antisense; GACCCCGAATGCAAGATCCAGGATC
>probe:Drosophila_2:1623304_at:211:215; Interrogation_Position=948; Antisense; AAGATCCAGGATCCAACGGTCCGAC
>probe:Drosophila_2:1623304_at:558:543; Interrogation_Position=956; Antisense; GGATCCAACGGTCCGACCGCAGATA
>probe:Drosophila_2:1623304_at:116:503; Interrogation_Position=966; Antisense; GTCCGACCGCAGATAAATCCTCATA
>probe:Drosophila_2:1623304_at:50:97; Interrogation_Position=976; Antisense; AGATAAATCCTCATAAATTCGCCGA
>probe:Drosophila_2:1623304_at:460:235; Interrogation_Position=981; Antisense; AATCCTCATAAATTCGCCGATGCCA
>probe:Drosophila_2:1623304_at:405:163; Interrogation_Position=990; Antisense; AAATTCGCCGATGCCATTGACACTG

Paste this into a BLAST search page for me
TGCCATTGACACTGCCGCGACCGAAGACCGAATCCTGACCAACGCCACGAGACCAAATCCCACAGCAATGCCATAACAGCAATGCCATAACTTATCCCGAATAACTTATCCCGACCGCAGTGAGGTTTATGACACCAGAACGACCCCGAAGAACGACCCCGAATGCAAGATCCAGGACCCCGAATGCAAGATCCAGGATCAAGATCCAGGATCCAACGGTCCGACGGATCCAACGGTCCGACCGCAGATAGTCCGACCGCAGATAAATCCTCATAAGATAAATCCTCATAAATTCGCCGAAATCCTCATAAATTCGCCGATGCCAAAATTCGCCGATGCCATTGACACTG

Full Affymetrix probeset data:

Annotations for 1623304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720