FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623305_at:

>probe:Drosophila_2:1623305_at:532:301; Interrogation_Position=2124; Antisense; CCGAGACGCCAAAGGTACCACATAA
>probe:Drosophila_2:1623305_at:73:3; Interrogation_Position=2131; Antisense; GCCAAAGGTACCACATAAAGTGTTT
>probe:Drosophila_2:1623305_at:569:161; Interrogation_Position=2172; Antisense; AAATTGGTGTGGGTGTGCGTATTAC
>probe:Drosophila_2:1623305_at:702:531; Interrogation_Position=2182; Antisense; GGGTGTGCGTATTACGAATGCAATT
>probe:Drosophila_2:1623305_at:5:137; Interrogation_Position=2195; Antisense; ACGAATGCAATTGTAAACTGAATAA
>probe:Drosophila_2:1623305_at:341:1; Interrogation_Position=2216; Antisense; ATAATAAAGCCGATTACATTACCAA
>probe:Drosophila_2:1623305_at:8:19; Interrogation_Position=2270; Antisense; ATATCATTTGTGCAACTTAACTAAA
>probe:Drosophila_2:1623305_at:33:173; Interrogation_Position=2294; Antisense; AAAGATATGTGCATACTGCTGTAAA
>probe:Drosophila_2:1623305_at:226:345; Interrogation_Position=2304; Antisense; GCATACTGCTGTAAATTAGTGAACA
>probe:Drosophila_2:1623305_at:678:703; Interrogation_Position=2379; Antisense; TTATATGTATCACTATCAAATTCGT
>probe:Drosophila_2:1623305_at:571:183; Interrogation_Position=2411; Antisense; AAAAGTCTTGCAAAGCTAAATCGAT
>probe:Drosophila_2:1623305_at:657:339; Interrogation_Position=2425; Antisense; GCTAAATCGATAAAGATGACTCAAA
>probe:Drosophila_2:1623305_at:535:213; Interrogation_Position=2437; Antisense; AAGATGACTCAAAGAAAGACCGAAA
>probe:Drosophila_2:1623305_at:338:391; Interrogation_Position=2450; Antisense; GAAAGACCGAAAAATTCACCACACA

Paste this into a BLAST search page for me
CCGAGACGCCAAAGGTACCACATAAGCCAAAGGTACCACATAAAGTGTTTAAATTGGTGTGGGTGTGCGTATTACGGGTGTGCGTATTACGAATGCAATTACGAATGCAATTGTAAACTGAATAAATAATAAAGCCGATTACATTACCAAATATCATTTGTGCAACTTAACTAAAAAAGATATGTGCATACTGCTGTAAAGCATACTGCTGTAAATTAGTGAACATTATATGTATCACTATCAAATTCGTAAAAGTCTTGCAAAGCTAAATCGATGCTAAATCGATAAAGATGACTCAAAAAGATGACTCAAAGAAAGACCGAAAGAAAGACCGAAAAATTCACCACACA

Full Affymetrix probeset data:

Annotations for 1623305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720