FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623308_at:

>probe:Drosophila_2:1623308_at:217:509; Interrogation_Position=111; Antisense; GTGCACATGCTACGAAAAGTCCTTT
>probe:Drosophila_2:1623308_at:450:1; Interrogation_Position=130; Antisense; TCCTTTTGCGAACTTAAACGTTGTG
>probe:Drosophila_2:1623308_at:563:141; Interrogation_Position=156; Antisense; ACTGAAGGTCCTGGGACGCGGCATT
>probe:Drosophila_2:1623308_at:216:569; Interrogation_Position=184; Antisense; GGCTTAAATCTACATGCCCAGGTTT
>probe:Drosophila_2:1623308_at:720:321; Interrogation_Position=199; Antisense; GCCCAGGTTTATAAGCTGCCCATTA
>probe:Drosophila_2:1623308_at:282:623; Interrogation_Position=215; Antisense; TGCCCATTAAATCTACGACTGCATG
>probe:Drosophila_2:1623308_at:423:57; Interrogation_Position=275; Antisense; ATGATATCTAAAGCTCCTGTCCCAA
>probe:Drosophila_2:1623308_at:95:663; Interrogation_Position=283; Antisense; TAAAGCTCCTGTCCCAAATGGTTTT
>probe:Drosophila_2:1623308_at:600:675; Interrogation_Position=308; Antisense; TATAAACTCAGGTTCATCGTGAAAA
>probe:Drosophila_2:1623308_at:237:47; Interrogation_Position=34; Antisense; ATCCGACTGTGGTCATATGTGGTCA
>probe:Drosophila_2:1623308_at:82:615; Interrogation_Position=358; Antisense; TGAAGTCCATGCTGAGGTTAATCTG
>probe:Drosophila_2:1623308_at:188:475; Interrogation_Position=374; Antisense; GTTAATCTGGGCATCGATCGCTGAG
>probe:Drosophila_2:1623308_at:473:595; Interrogation_Position=51; Antisense; TGTGGTCATTAATTTGCTACTCAGT
>probe:Drosophila_2:1623308_at:116:513; Interrogation_Position=74; Antisense; GTGATTCAAACGCTTTATTCAAGTT

Paste this into a BLAST search page for me
GTGCACATGCTACGAAAAGTCCTTTTCCTTTTGCGAACTTAAACGTTGTGACTGAAGGTCCTGGGACGCGGCATTGGCTTAAATCTACATGCCCAGGTTTGCCCAGGTTTATAAGCTGCCCATTATGCCCATTAAATCTACGACTGCATGATGATATCTAAAGCTCCTGTCCCAATAAAGCTCCTGTCCCAAATGGTTTTTATAAACTCAGGTTCATCGTGAAAAATCCGACTGTGGTCATATGTGGTCATGAAGTCCATGCTGAGGTTAATCTGGTTAATCTGGGCATCGATCGCTGAGTGTGGTCATTAATTTGCTACTCAGTGTGATTCAAACGCTTTATTCAAGTT

Full Affymetrix probeset data:

Annotations for 1623308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720