FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623309_at:

>probe:Drosophila_2:1623309_at:253:627; Interrogation_Position=1198; Antisense; TGCCGTATGTGTGGTTCGCGTTTCA
>probe:Drosophila_2:1623309_at:318:61; Interrogation_Position=1233; Antisense; ATGTCGCACTGCTGCTACAATCCGA
>probe:Drosophila_2:1623309_at:456:665; Interrogation_Position=1248; Antisense; TACAATCCGATCATCTACTGCTACA
>probe:Drosophila_2:1623309_at:105:55; Interrogation_Position=1272; Antisense; ATGAACGCCCGTTTCAGGAGCGGAT
>probe:Drosophila_2:1623309_at:689:461; Interrogation_Position=1294; Antisense; GATTCGTCCAGCTGATGCACCGTAT
>probe:Drosophila_2:1623309_at:424:603; Interrogation_Position=1358; Antisense; TGATCGCATGAACGCAACTTCCGGA
>probe:Drosophila_2:1623309_at:30:113; Interrogation_Position=1391; Antisense; AGCACTTCCTCTCAATCGAATGAAC
>probe:Drosophila_2:1623309_at:570:137; Interrogation_Position=1451; Antisense; ACGAGCGACATCTTTGCGAGCGAAC
>probe:Drosophila_2:1623309_at:295:415; Interrogation_Position=1468; Antisense; GAGCGAACCCATTATCGTGCGGCGA
>probe:Drosophila_2:1623309_at:712:127; Interrogation_Position=1499; Antisense; ACCACTGCGGTAGCTGTCATATCAA
>probe:Drosophila_2:1623309_at:496:31; Interrogation_Position=1527; Antisense; ATAAAACTGATTCACCGGTGCGCCG
>probe:Drosophila_2:1623309_at:666:299; Interrogation_Position=1547; Antisense; CGCCGATCAGGAAGCTCAGGTGGAA
>probe:Drosophila_2:1623309_at:668:595; Interrogation_Position=1666; Antisense; TGTGTGCGTGTTTTAGTCCGAGTCC
>probe:Drosophila_2:1623309_at:63:505; Interrogation_Position=1681; Antisense; GTCCGAGTCCTTTAAATTGTATTGT

Paste this into a BLAST search page for me
TGCCGTATGTGTGGTTCGCGTTTCAATGTCGCACTGCTGCTACAATCCGATACAATCCGATCATCTACTGCTACAATGAACGCCCGTTTCAGGAGCGGATGATTCGTCCAGCTGATGCACCGTATTGATCGCATGAACGCAACTTCCGGAAGCACTTCCTCTCAATCGAATGAACACGAGCGACATCTTTGCGAGCGAACGAGCGAACCCATTATCGTGCGGCGAACCACTGCGGTAGCTGTCATATCAAATAAAACTGATTCACCGGTGCGCCGCGCCGATCAGGAAGCTCAGGTGGAATGTGTGCGTGTTTTAGTCCGAGTCCGTCCGAGTCCTTTAAATTGTATTGT

Full Affymetrix probeset data:

Annotations for 1623309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720