FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623311_at:

>probe:Drosophila_2:1623311_at:254:625; Interrogation_Position=113; Antisense; TGCCCAAGGGCAGACTGGAGTATCT
>probe:Drosophila_2:1623311_at:541:57; Interrogation_Position=13; Antisense; ATGAGGACGACAACCTTCTGGCCCG
>probe:Drosophila_2:1623311_at:568:483; Interrogation_Position=132; Antisense; GTATCTGAAGCGATTGCTGCCCTAT
>probe:Drosophila_2:1623311_at:397:7; Interrogation_Position=144; Antisense; ATTGCTGCCCTATCTGCAGAATCAA
>probe:Drosophila_2:1623311_at:43:351; Interrogation_Position=159; Antisense; GCAGAATCAATCAGAGGACTGCCTC
>probe:Drosophila_2:1623311_at:592:555; Interrogation_Position=174; Antisense; GGACTGCCTCTATCTAAATATTTAT
>probe:Drosophila_2:1623311_at:392:505; Interrogation_Position=199; Antisense; GTGCCCATTCAAGCTAAAACCGAGA
>probe:Drosophila_2:1623311_at:218:105; Interrogation_Position=221; Antisense; AGAAAAATGACATGACCGTGTCGGG
>probe:Drosophila_2:1623311_at:211:717; Interrogation_Position=28; Antisense; TTCTGGCCCGTTGGCCACAGATTCA
>probe:Drosophila_2:1623311_at:418:729; Interrogation_Position=38; Antisense; TTGGCCACAGATTCAGCCCGGTTTG
>probe:Drosophila_2:1623311_at:88:541; Interrogation_Position=57; Antisense; GGTTTGCCCGCAGAGATTGCCGGAC
>probe:Drosophila_2:1623311_at:198:429; Interrogation_Position=69; Antisense; GAGATTGCCGGACATTCACAACGAG
>probe:Drosophila_2:1623311_at:546:13; Interrogation_Position=82; Antisense; ATTCACAACGAGACGGCGGCCCTGG
>probe:Drosophila_2:1623311_at:19:289; Interrogation_Position=95; Antisense; CGGCGGCCCTGGAACGGATGCCCAA

Paste this into a BLAST search page for me
TGCCCAAGGGCAGACTGGAGTATCTATGAGGACGACAACCTTCTGGCCCGGTATCTGAAGCGATTGCTGCCCTATATTGCTGCCCTATCTGCAGAATCAAGCAGAATCAATCAGAGGACTGCCTCGGACTGCCTCTATCTAAATATTTATGTGCCCATTCAAGCTAAAACCGAGAAGAAAAATGACATGACCGTGTCGGGTTCTGGCCCGTTGGCCACAGATTCATTGGCCACAGATTCAGCCCGGTTTGGGTTTGCCCGCAGAGATTGCCGGACGAGATTGCCGGACATTCACAACGAGATTCACAACGAGACGGCGGCCCTGGCGGCGGCCCTGGAACGGATGCCCAA

Full Affymetrix probeset data:

Annotations for 1623311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720