Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623313_at:

>probe:Drosophila_2:1623313_at:570:643; Interrogation_Position=102; Antisense; TCTCGTCAAGTTGGGCGTGCATTGT
>probe:Drosophila_2:1623313_at:106:253; Interrogation_Position=108; Antisense; CAAGTTGGGCGTGCATTGTGTGATT
>probe:Drosophila_2:1623313_at:372:511; Interrogation_Position=127; Antisense; GTGATTGGCAAGAAGGTTGCGATTA
>probe:Drosophila_2:1623313_at:110:183; Interrogation_Position=151; Antisense; AAAATAATCAATCGCGAGAAACTCA
>probe:Drosophila_2:1623313_at:586:423; Interrogation_Position=166; Antisense; GAGAAACTCAGCGAATCGGTGCTAA
>probe:Drosophila_2:1623313_at:504:193; Interrogation_Position=170; Antisense; AACTCAGCGAATCGGTGCTAATGAA
>probe:Drosophila_2:1623313_at:716:337; Interrogation_Position=186; Antisense; GCTAATGAAGAACGCACCACGTCCA
>probe:Drosophila_2:1623313_at:387:375; Interrogation_Position=192; Antisense; GAAGAACGCACCACGTCCATTGTAA
>probe:Drosophila_2:1623313_at:497:423; Interrogation_Position=22; Antisense; GAGAACAATGTCACGGCGGAGAATT
>probe:Drosophila_2:1623313_at:156:651; Interrogation_Position=32; Antisense; TCACGGCGGAGAATTGCCAATTTGT
>probe:Drosophila_2:1623313_at:495:577; Interrogation_Position=59; Antisense; GGCCCTATCGCCTGGAGAAAACCCT
>probe:Drosophila_2:1623313_at:726:299; Interrogation_Position=67; Antisense; CGCCTGGAGAAAACCCTTGGCAAGG
>probe:Drosophila_2:1623313_at:509:433; Interrogation_Position=90; Antisense; GGGTCAAACGGGTCTCGTCAAGTTG
>probe:Drosophila_2:1623313_at:328:255; Interrogation_Position=94; Antisense; CAAACGGGTCTCGTCAAGTTGGGCG

Paste this into a BLAST search page for me
TCTCGTCAAGTTGGGCGTGCATTGTCAAGTTGGGCGTGCATTGTGTGATTGTGATTGGCAAGAAGGTTGCGATTAAAAATAATCAATCGCGAGAAACTCAGAGAAACTCAGCGAATCGGTGCTAAAACTCAGCGAATCGGTGCTAATGAAGCTAATGAAGAACGCACCACGTCCAGAAGAACGCACCACGTCCATTGTAAGAGAACAATGTCACGGCGGAGAATTTCACGGCGGAGAATTGCCAATTTGTGGCCCTATCGCCTGGAGAAAACCCTCGCCTGGAGAAAACCCTTGGCAAGGGGGTCAAACGGGTCTCGTCAAGTTGCAAACGGGTCTCGTCAAGTTGGGCG

Full Affymetrix probeset data:

Annotations for 1623313_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime