Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623314_at:

>probe:Drosophila_2:1623314_at:248:139; Interrogation_Position=1415; Antisense; ACGTATTCAGGTTTGTCTTTCAGTT
>probe:Drosophila_2:1623314_at:103:481; Interrogation_Position=1417; Antisense; GTATTCAGGTTTGTCTTTCAGTTTT
>probe:Drosophila_2:1623314_at:204:649; Interrogation_Position=1421; Antisense; TCAGGTTTGTCTTTCAGTTTTGTTT
>probe:Drosophila_2:1623314_at:230:245; Interrogation_Position=1446; Antisense; AATTATATTCAGTTTGTAGACCTTT
>probe:Drosophila_2:1623314_at:248:687; Interrogation_Position=1449; Antisense; TATATTCAGTTTGTAGACCTTTTTT
>probe:Drosophila_2:1623314_at:635:485; Interrogation_Position=1461; Antisense; GTAGACCTTTTTTTGCAGAGCTCAA
>probe:Drosophila_2:1623314_at:436:351; Interrogation_Position=1475; Antisense; GCAGAGCTCAATTTATTTATATTTT
>probe:Drosophila_2:1623314_at:569:723; Interrogation_Position=1499; Antisense; TTGTAAATTATGTCAAACTAGCAAT
>probe:Drosophila_2:1623314_at:72:29; Interrogation_Position=1508; Antisense; ATGTCAAACTAGCAATTAACTAATT
>probe:Drosophila_2:1623314_at:191:653; Interrogation_Position=1543; Antisense; TAATCGACCCTTAATGTTTTGGGCG
>probe:Drosophila_2:1623314_at:603:389; Interrogation_Position=1548; Antisense; GACCCTTAATGTTTTGGGCGGCACA
>probe:Drosophila_2:1623314_at:22:599; Interrogation_Position=1557; Antisense; TGTTTTGGGCGGCACATACGAAAAT
>probe:Drosophila_2:1623314_at:16:725; Interrogation_Position=1561; Antisense; TTGGGCGGCACATACGAAAATGTAT
>probe:Drosophila_2:1623314_at:151:573; Interrogation_Position=1564; Antisense; GGCGGCACATACGAAAATGTATTTC

Paste this into a BLAST search page for me
ACGTATTCAGGTTTGTCTTTCAGTTGTATTCAGGTTTGTCTTTCAGTTTTTCAGGTTTGTCTTTCAGTTTTGTTTAATTATATTCAGTTTGTAGACCTTTTATATTCAGTTTGTAGACCTTTTTTGTAGACCTTTTTTTGCAGAGCTCAAGCAGAGCTCAATTTATTTATATTTTTTGTAAATTATGTCAAACTAGCAATATGTCAAACTAGCAATTAACTAATTTAATCGACCCTTAATGTTTTGGGCGGACCCTTAATGTTTTGGGCGGCACATGTTTTGGGCGGCACATACGAAAATTTGGGCGGCACATACGAAAATGTATGGCGGCACATACGAAAATGTATTTC

Full Affymetrix probeset data:

Annotations for 1623314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime