Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623315_at:

>probe:Drosophila_2:1623315_at:80:619; Interrogation_Position=137; Antisense; TGCATGGATTTGCAGCACCTGACCG
>probe:Drosophila_2:1623315_at:503:469; Interrogation_Position=15; Antisense; GTTGCCGCATATGCGCCAAAACTTT
>probe:Drosophila_2:1623315_at:284:649; Interrogation_Position=175; Antisense; TCAGCACGATAATTGTTCCGACAGC
>probe:Drosophila_2:1623315_at:391:471; Interrogation_Position=189; Antisense; GTTCCGACAGCGATTCGATTGTTTT
>probe:Drosophila_2:1623315_at:495:587; Interrogation_Position=213; Antisense; TGGAGCCGGGCTGCGAGATCACCAA
>probe:Drosophila_2:1623315_at:92:193; Interrogation_Position=259; Antisense; AACTATGCGCACCTGTCTCAGCGAA
>probe:Drosophila_2:1623315_at:540:597; Interrogation_Position=272; Antisense; TGTCTCAGCGAACTGACCAGCGATG
>probe:Drosophila_2:1623315_at:227:137; Interrogation_Position=309; Antisense; ACGACTCTCGCTGGCACTTCAAGAA
>probe:Drosophila_2:1623315_at:315:379; Interrogation_Position=331; Antisense; GAACCTAGAGCATCATCTTGAAGGA
>probe:Drosophila_2:1623315_at:529:191; Interrogation_Position=34; Antisense; AACTTTGGGCGAATCCTGCGGCGGT
>probe:Drosophila_2:1623315_at:573:223; Interrogation_Position=351; Antisense; AAGGATTGAGCCCTGAATGCGCCAT
>probe:Drosophila_2:1623315_at:349:369; Interrogation_Position=365; Antisense; GAATGCGCCATTGCGACTTTCTGCG
>probe:Drosophila_2:1623315_at:119:331; Interrogation_Position=63; Antisense; GCGGATTTTCCGGTCAATGTGAGCC
>probe:Drosophila_2:1623315_at:206:85; Interrogation_Position=96; Antisense; AGTGTGTGACCAAGCTGCCCATTAG

Paste this into a BLAST search page for me
TGCATGGATTTGCAGCACCTGACCGGTTGCCGCATATGCGCCAAAACTTTTCAGCACGATAATTGTTCCGACAGCGTTCCGACAGCGATTCGATTGTTTTTGGAGCCGGGCTGCGAGATCACCAAAACTATGCGCACCTGTCTCAGCGAATGTCTCAGCGAACTGACCAGCGATGACGACTCTCGCTGGCACTTCAAGAAGAACCTAGAGCATCATCTTGAAGGAAACTTTGGGCGAATCCTGCGGCGGTAAGGATTGAGCCCTGAATGCGCCATGAATGCGCCATTGCGACTTTCTGCGGCGGATTTTCCGGTCAATGTGAGCCAGTGTGTGACCAAGCTGCCCATTAG

Full Affymetrix probeset data:

Annotations for 1623315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime