Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623316_at:

>probe:Drosophila_2:1623316_at:570:315; Interrogation_Position=1132; Antisense; GCCTTGATGCCGACTTGGTACTTGT
>probe:Drosophila_2:1623316_at:280:591; Interrogation_Position=1147; Antisense; TGGTACTTGTGCACCCTGGACAGGT
>probe:Drosophila_2:1623316_at:32:587; Interrogation_Position=1163; Antisense; TGGACAGGTCCAACCGGTGCAACCA
>probe:Drosophila_2:1623316_at:303:535; Interrogation_Position=1178; Antisense; GGTGCAACCACTTTGCCCGAGTAAT
>probe:Drosophila_2:1623316_at:529:89; Interrogation_Position=1197; Antisense; AGTAATCCACAGTCCCGGCGTGCAA
>probe:Drosophila_2:1623316_at:355:343; Interrogation_Position=1223; Antisense; GCTTGATTGCCGCAGGCCTAGAAGA
>probe:Drosophila_2:1623316_at:252:99; Interrogation_Position=1319; Antisense; AGAGGCTCTTGGTCCGCGACTGGAT
>probe:Drosophila_2:1623316_at:277:405; Interrogation_Position=1408; Antisense; GACGCGTTCAAAGAATACCTGGCCA
>probe:Drosophila_2:1623316_at:400:27; Interrogation_Position=1422; Antisense; ATACCTGGCCAGGATTATCTGCTGC
>probe:Drosophila_2:1623316_at:232:413; Interrogation_Position=1483; Antisense; GAGGTGTACCGCAGGGACTTCCGCT
>probe:Drosophila_2:1623316_at:560:91; Interrogation_Position=1550; Antisense; AGTATTCTGTACCTTCCTGCTACTT
>probe:Drosophila_2:1623316_at:700:667; Interrogation_Position=1570; Antisense; TACTTCTGGGCAGTCGTGATTCTGT
>probe:Drosophila_2:1623316_at:588:603; Interrogation_Position=1586; Antisense; TGATTCTGTCAGTTCCGTCCATTGT
>probe:Drosophila_2:1623316_at:219:415; Interrogation_Position=1677; Antisense; GACCAATTCACCGACCTGATTTAGA

Paste this into a BLAST search page for me
GCCTTGATGCCGACTTGGTACTTGTTGGTACTTGTGCACCCTGGACAGGTTGGACAGGTCCAACCGGTGCAACCAGGTGCAACCACTTTGCCCGAGTAATAGTAATCCACAGTCCCGGCGTGCAAGCTTGATTGCCGCAGGCCTAGAAGAAGAGGCTCTTGGTCCGCGACTGGATGACGCGTTCAAAGAATACCTGGCCAATACCTGGCCAGGATTATCTGCTGCGAGGTGTACCGCAGGGACTTCCGCTAGTATTCTGTACCTTCCTGCTACTTTACTTCTGGGCAGTCGTGATTCTGTTGATTCTGTCAGTTCCGTCCATTGTGACCAATTCACCGACCTGATTTAGA

Full Affymetrix probeset data:

Annotations for 1623316_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime