Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623318_s_at:

>probe:Drosophila_2:1623318_s_at:444:437; Interrogation_Position=104; Antisense; GAGGACAAGGCTTGTGGTCCCCACG
>probe:Drosophila_2:1623318_s_at:159:727; Interrogation_Position=115; Antisense; TTGTGGTCCCCACGCCTACTACAAT
>probe:Drosophila_2:1623318_s_at:470:145; Interrogation_Position=132; Antisense; ACTACAATTACGCCCGGCACACTTG
>probe:Drosophila_2:1623318_s_at:573:381; Interrogation_Position=16; Antisense; GAACGTATTCAATGGTTTCTTGCTA
>probe:Drosophila_2:1623318_s_at:350:653; Interrogation_Position=24; Antisense; TCAATGGTTTCTTGCTAGTCTTCCT
>probe:Drosophila_2:1623318_s_at:404:229; Interrogation_Position=26; Antisense; AATGGTTTCTTGCTAGTCTTCCTGG
>probe:Drosophila_2:1623318_s_at:571:713; Interrogation_Position=32; Antisense; TTCTTGCTAGTCTTCCTGGGCCTGG
>probe:Drosophila_2:1623318_s_at:674:593; Interrogation_Position=48; Antisense; TGGGCCTGGCCCTCAGCTCTGTGGA
>probe:Drosophila_2:1623318_s_at:241:577; Interrogation_Position=55; Antisense; GGCCCTCAGCTCTGTGGATGCACAG
>probe:Drosophila_2:1623318_s_at:423:547; Interrogation_Position=70; Antisense; GGATGCACAGATAGCAACACGCCAG
>probe:Drosophila_2:1623318_s_at:231:357; Interrogation_Position=74; Antisense; GCACAGATAGCAACACGCCAGGAAA
>probe:Drosophila_2:1623318_s_at:538:25; Interrogation_Position=80; Antisense; ATAGCAACACGCCAGGAAACCTCGG
>probe:Drosophila_2:1623318_s_at:189:157; Interrogation_Position=86; Antisense; ACACGCCAGGAAACCTCGGAGGACA
>probe:Drosophila_2:1623318_s_at:642:391; Interrogation_Position=95; Antisense; GAAACCTCGGAGGACAAGGCTTGTG

Paste this into a BLAST search page for me
GAGGACAAGGCTTGTGGTCCCCACGTTGTGGTCCCCACGCCTACTACAATACTACAATTACGCCCGGCACACTTGGAACGTATTCAATGGTTTCTTGCTATCAATGGTTTCTTGCTAGTCTTCCTAATGGTTTCTTGCTAGTCTTCCTGGTTCTTGCTAGTCTTCCTGGGCCTGGTGGGCCTGGCCCTCAGCTCTGTGGAGGCCCTCAGCTCTGTGGATGCACAGGGATGCACAGATAGCAACACGCCAGGCACAGATAGCAACACGCCAGGAAAATAGCAACACGCCAGGAAACCTCGGACACGCCAGGAAACCTCGGAGGACAGAAACCTCGGAGGACAAGGCTTGTG

Full Affymetrix probeset data:

Annotations for 1623318_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime