FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623319_at:

>probe:Drosophila_2:1623319_at:492:67; Interrogation_Position=107; Antisense; ATGGCTTGCCGGATGGTCGTGCCAC
>probe:Drosophila_2:1623319_at:261:319; Interrogation_Position=134; Antisense; GCCGTTCAGTGCCTGGATTGACCAA
>probe:Drosophila_2:1623319_at:113:223; Interrogation_Position=157; Antisense; AAGGATCAAGTGGAGCTCTGCTACA
>probe:Drosophila_2:1623319_at:551:553; Interrogation_Position=168; Antisense; GGAGCTCTGCTACAAGGCCAGTGAT
>probe:Drosophila_2:1623319_at:457:407; Interrogation_Position=195; Antisense; GACGGCGGCAGCTCTCGAAGGACTC
>probe:Drosophila_2:1623319_at:551:635; Interrogation_Position=209; Antisense; TCGAAGGACTCGACATGGCCATACG
>probe:Drosophila_2:1623319_at:428:69; Interrogation_Position=223; Antisense; ATGGCCATACGAGAATGTCAAATTC
>probe:Drosophila_2:1623319_at:6:713; Interrogation_Position=245; Antisense; TTCAGTTTCAATGGCATCGGTGGAA
>probe:Drosophila_2:1623319_at:606:61; Interrogation_Position=255; Antisense; ATGGCATCGGTGGAACTGTTCGTCG
>probe:Drosophila_2:1623319_at:59:563; Interrogation_Position=266; Antisense; GGAACTGTTCGTCGCTGAGCACAAA
>probe:Drosophila_2:1623319_at:491:609; Interrogation_Position=281; Antisense; TGAGCACAAAGAGCCGCAATCCGCA
>probe:Drosophila_2:1623319_at:481:347; Interrogation_Position=303; Antisense; GCATGCCTCCAGTTTGCTGAAGAAA
>probe:Drosophila_2:1623319_at:388:465; Interrogation_Position=83; Antisense; GTTGGATACTGGATGTTGGGCTCTA
>probe:Drosophila_2:1623319_at:593:57; Interrogation_Position=95; Antisense; ATGTTGGGCTCTATGGCTTGCCGGA

Paste this into a BLAST search page for me
ATGGCTTGCCGGATGGTCGTGCCACGCCGTTCAGTGCCTGGATTGACCAAAAGGATCAAGTGGAGCTCTGCTACAGGAGCTCTGCTACAAGGCCAGTGATGACGGCGGCAGCTCTCGAAGGACTCTCGAAGGACTCGACATGGCCATACGATGGCCATACGAGAATGTCAAATTCTTCAGTTTCAATGGCATCGGTGGAAATGGCATCGGTGGAACTGTTCGTCGGGAACTGTTCGTCGCTGAGCACAAATGAGCACAAAGAGCCGCAATCCGCAGCATGCCTCCAGTTTGCTGAAGAAAGTTGGATACTGGATGTTGGGCTCTAATGTTGGGCTCTATGGCTTGCCGGA

Full Affymetrix probeset data:

Annotations for 1623319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720