Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623320_at:

>probe:Drosophila_2:1623320_at:197:659; Interrogation_Position=3469; Antisense; TAAGATCGTATTGGGCTTCTCTGTC
>probe:Drosophila_2:1623320_at:252:525; Interrogation_Position=3481; Antisense; GGGCTTCTCTGTCTCGAAACTATAG
>probe:Drosophila_2:1623320_at:576:25; Interrogation_Position=3537; Antisense; ATAGTTGCAGTTTACCATTTGGATA
>probe:Drosophila_2:1623320_at:490:457; Interrogation_Position=3558; Antisense; GATACCAATTTTCCCACTTAAGCAT
>probe:Drosophila_2:1623320_at:701:191; Interrogation_Position=3592; Antisense; AACTTTGCAGTCAGGGAGGTACACA
>probe:Drosophila_2:1623320_at:474:433; Interrogation_Position=3607; Antisense; GAGGTACACAGTCTTTGCTCCAAGA
>probe:Drosophila_2:1623320_at:599:553; Interrogation_Position=3639; Antisense; GGACCGAATGGACCTTAAATCACGA
>probe:Drosophila_2:1623320_at:413:647; Interrogation_Position=3658; Antisense; TCACGAAGATTGAACGCACCCTTGC
>probe:Drosophila_2:1623320_at:257:355; Interrogation_Position=3673; Antisense; GCACCCTTGCTTTAACCTGATGAAT
>probe:Drosophila_2:1623320_at:431:421; Interrogation_Position=3691; Antisense; GATGAATCCTACTCTAGGTCCTTAC
>probe:Drosophila_2:1623320_at:611:613; Interrogation_Position=3746; Antisense; TGAATACCCTTGCAAAACTAGCTTG
>probe:Drosophila_2:1623320_at:505:79; Interrogation_Position=3855; Antisense; AGGGTCATAGGCTTATAGTCTCCGA
>probe:Drosophila_2:1623320_at:498:687; Interrogation_Position=3868; Antisense; TATAGTCTCCGAAGTCCGAGGGTCT
>probe:Drosophila_2:1623320_at:420:537; Interrogation_Position=3888; Antisense; GGTCTTCCCTTCATGTTATACTAAT

Paste this into a BLAST search page for me
TAAGATCGTATTGGGCTTCTCTGTCGGGCTTCTCTGTCTCGAAACTATAGATAGTTGCAGTTTACCATTTGGATAGATACCAATTTTCCCACTTAAGCATAACTTTGCAGTCAGGGAGGTACACAGAGGTACACAGTCTTTGCTCCAAGAGGACCGAATGGACCTTAAATCACGATCACGAAGATTGAACGCACCCTTGCGCACCCTTGCTTTAACCTGATGAATGATGAATCCTACTCTAGGTCCTTACTGAATACCCTTGCAAAACTAGCTTGAGGGTCATAGGCTTATAGTCTCCGATATAGTCTCCGAAGTCCGAGGGTCTGGTCTTCCCTTCATGTTATACTAAT

Full Affymetrix probeset data:

Annotations for 1623320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime