FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623322_at:

>probe:Drosophila_2:1623322_at:128:617; Interrogation_Position=101; Antisense; TGCAATATCATGTTAACGCCGCCTT
>probe:Drosophila_2:1623322_at:535:133; Interrogation_Position=116; Antisense; ACGCCGCCTTAGACGTCGTGGAGGA
>probe:Drosophila_2:1623322_at:252:3; Interrogation_Position=151; Antisense; ATTGGCAAGGGTGCTCCGGAGTCCA
>probe:Drosophila_2:1623322_at:151:627; Interrogation_Position=172; Antisense; TCCAAGGAGCTGTACCTGGGACTGC
>probe:Drosophila_2:1623322_at:669:593; Interrogation_Position=188; Antisense; TGGGACTGCTCTACTCGACAGAGAA
>probe:Drosophila_2:1623322_at:480:27; Interrogation_Position=222; Antisense; ATACGGCTTTGTGACCAACACTCGG
>probe:Drosophila_2:1623322_at:568:25; Interrogation_Position=256; Antisense; ATAGTGGTCATCGACTCCAGCAACG
>probe:Drosophila_2:1623322_at:730:601; Interrogation_Position=271; Antisense; TCCAGCAACGTTGCCCTTCGGGAAA
>probe:Drosophila_2:1623322_at:4:111; Interrogation_Position=306; Antisense; AGCAATCTTCCGAAATCTCCACTTG
>probe:Drosophila_2:1623322_at:618:49; Interrogation_Position=341; Antisense; ATGCCATCTGCAATCCCTTTTACAT
>probe:Drosophila_2:1623322_at:576:303; Interrogation_Position=368; Antisense; CCGGCGAATCGCTGACTTCAAAGAA
>probe:Drosophila_2:1623322_at:661:171; Interrogation_Position=387; Antisense; AAAGAAGTTCGATCGCGCTGTCCAG
>probe:Drosophila_2:1623322_at:562:331; Interrogation_Position=422; Antisense; GCGGCACTGCCTAGCTGTAGATTAA
>probe:Drosophila_2:1623322_at:281:601; Interrogation_Position=62; Antisense; TGTACCTGACCACATCCGATATGGA

Paste this into a BLAST search page for me
TGCAATATCATGTTAACGCCGCCTTACGCCGCCTTAGACGTCGTGGAGGAATTGGCAAGGGTGCTCCGGAGTCCATCCAAGGAGCTGTACCTGGGACTGCTGGGACTGCTCTACTCGACAGAGAAATACGGCTTTGTGACCAACACTCGGATAGTGGTCATCGACTCCAGCAACGTCCAGCAACGTTGCCCTTCGGGAAAAGCAATCTTCCGAAATCTCCACTTGATGCCATCTGCAATCCCTTTTACATCCGGCGAATCGCTGACTTCAAAGAAAAAGAAGTTCGATCGCGCTGTCCAGGCGGCACTGCCTAGCTGTAGATTAATGTACCTGACCACATCCGATATGGA

Full Affymetrix probeset data:

Annotations for 1623322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720