Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623324_at:

>probe:Drosophila_2:1623324_at:698:283; Interrogation_Position=3069; Antisense; CTGCGAGAGCCTGTACGAGGGCAAC
>probe:Drosophila_2:1623324_at:453:199; Interrogation_Position=3091; Antisense; AACGAGCTGAGCTGAATGCGGCGCA
>probe:Drosophila_2:1623324_at:341:51; Interrogation_Position=3106; Antisense; ATGCGGCGCAGGGACGAACTTCAAC
>probe:Drosophila_2:1623324_at:717:555; Interrogation_Position=3117; Antisense; GGACGAACTTCAACCACATGCAATT
>probe:Drosophila_2:1623324_at:336:547; Interrogation_Position=3207; Antisense; GGAGGCCTTGTAGAATACGTGTATT
>probe:Drosophila_2:1623324_at:435:479; Interrogation_Position=3227; Antisense; GTATTAGCCGTAGGGACCAACCACT
>probe:Drosophila_2:1623324_at:684:307; Interrogation_Position=3276; Antisense; CCAGTAGCGCGTCAACCGTAGTTAA
>probe:Drosophila_2:1623324_at:442:485; Interrogation_Position=3293; Antisense; GTAGTTAAGATCTTGCACCCTCTTC
>probe:Drosophila_2:1623324_at:238:349; Interrogation_Position=3332; Antisense; GCAGGTCTTTCAACCCAGATACATA
>probe:Drosophila_2:1623324_at:610:419; Interrogation_Position=3391; Antisense; GAGCATCACAAGTTCGTAGTTAGTT
>probe:Drosophila_2:1623324_at:724:361; Interrogation_Position=3444; Antisense; GAATTCCAAACTAAACACTACGCTA
>probe:Drosophila_2:1623324_at:667:187; Interrogation_Position=3457; Antisense; AACACTACGCTAGCCTAAGATTTTT
>probe:Drosophila_2:1623324_at:343:281; Interrogation_Position=3541; Antisense; CTGCCCGCCGAAGTGGGCGTAAATT
>probe:Drosophila_2:1623324_at:728:573; Interrogation_Position=3556; Antisense; GGCGTAAATTCGGTGTCTTCGAGAA

Paste this into a BLAST search page for me
CTGCGAGAGCCTGTACGAGGGCAACAACGAGCTGAGCTGAATGCGGCGCAATGCGGCGCAGGGACGAACTTCAACGGACGAACTTCAACCACATGCAATTGGAGGCCTTGTAGAATACGTGTATTGTATTAGCCGTAGGGACCAACCACTCCAGTAGCGCGTCAACCGTAGTTAAGTAGTTAAGATCTTGCACCCTCTTCGCAGGTCTTTCAACCCAGATACATAGAGCATCACAAGTTCGTAGTTAGTTGAATTCCAAACTAAACACTACGCTAAACACTACGCTAGCCTAAGATTTTTCTGCCCGCCGAAGTGGGCGTAAATTGGCGTAAATTCGGTGTCTTCGAGAA

Full Affymetrix probeset data:

Annotations for 1623324_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime