Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623326_a_at:

>probe:Drosophila_2:1623326_a_at:105:223; Interrogation_Position=332; Antisense; AAGGGCTTCTACTCGTTCTCGTGCA
>probe:Drosophila_2:1623326_a_at:358:589; Interrogation_Position=365; Antisense; TGGATATTCTTCACCAGCGCGGTTA
>probe:Drosophila_2:1623326_a_at:425:207; Interrogation_Position=458; Antisense; AAGCAGGTGCTTCTTGGACCCGGCA
>probe:Drosophila_2:1623326_a_at:68:115; Interrogation_Position=512; Antisense; AGCTTACCCTTGATTCGTTAACCAT
>probe:Drosophila_2:1623326_a_at:202:21; Interrogation_Position=560; Antisense; ATATTAGCTCTACGATAACCGGCAT
>probe:Drosophila_2:1623326_a_at:319:559; Interrogation_Position=586; Antisense; GGAAATCCGGAAATTGCCACACGTT
>probe:Drosophila_2:1623326_a_at:287:9; Interrogation_Position=598; Antisense; ATTGCCACACGTTAGCTTAAGTTTG
>probe:Drosophila_2:1623326_a_at:320:721; Interrogation_Position=620; Antisense; TTGTCGATACCAATCAATCCCAGTC
>probe:Drosophila_2:1623326_a_at:694:163; Interrogation_Position=646; Antisense; AAATCGAGCGGTGCAGGACGTCCAG
>probe:Drosophila_2:1623326_a_at:646:13; Interrogation_Position=698; Antisense; ATTAAATGCCACTTCACAGCGCAGC
>probe:Drosophila_2:1623326_a_at:108:709; Interrogation_Position=725; Antisense; TTACGCATCCACACTCTATGAACAT
>probe:Drosophila_2:1623326_a_at:254:169; Interrogation_Position=763; Antisense; AAAGGACGTCCTCATCAATCGAAAC
>probe:Drosophila_2:1623326_a_at:423:387; Interrogation_Position=783; Antisense; GAAACGAGCCGTTGCAAAACTTCAG
>probe:Drosophila_2:1623326_a_at:42:117; Interrogation_Position=817; Antisense; AGCATTGCAGTTGGCGTACAGTGTA

Paste this into a BLAST search page for me
AAGGGCTTCTACTCGTTCTCGTGCATGGATATTCTTCACCAGCGCGGTTAAAGCAGGTGCTTCTTGGACCCGGCAAGCTTACCCTTGATTCGTTAACCATATATTAGCTCTACGATAACCGGCATGGAAATCCGGAAATTGCCACACGTTATTGCCACACGTTAGCTTAAGTTTGTTGTCGATACCAATCAATCCCAGTCAAATCGAGCGGTGCAGGACGTCCAGATTAAATGCCACTTCACAGCGCAGCTTACGCATCCACACTCTATGAACATAAAGGACGTCCTCATCAATCGAAACGAAACGAGCCGTTGCAAAACTTCAGAGCATTGCAGTTGGCGTACAGTGTA

Full Affymetrix probeset data:

Annotations for 1623326_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime