FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623328_at:

>probe:Drosophila_2:1623328_at:548:413; Interrogation_Position=1012; Antisense; GACCAGTGCGACTATCCTGAAAACT
>probe:Drosophila_2:1623328_at:293:221; Interrogation_Position=1135; Antisense; AAGTGTAACTTCAACTGCGCCGTCG
>probe:Drosophila_2:1623328_at:424:323; Interrogation_Position=1151; Antisense; GCGCCGTCGAGCAATATTGTCCGAA
>probe:Drosophila_2:1623328_at:689:71; Interrogation_Position=1220; Antisense; AGGACTATGTTTGCCCGTGGGAGTA
>probe:Drosophila_2:1623328_at:383:231; Interrogation_Position=1264; Antisense; AATGCAGGACCTTCGGGAATCGCCT
>probe:Drosophila_2:1623328_at:527:429; Interrogation_Position=1293; Antisense; GAGTAATGGCCGTTGCATGGGACAA
>probe:Drosophila_2:1623328_at:394:1; Interrogation_Position=1309; Antisense; ATGGGACAACGTGAGGGTACCTACT
>probe:Drosophila_2:1623328_at:219:241; Interrogation_Position=1357; Antisense; AATTACGTCGTCTGCCAGTGTGAAT
>probe:Drosophila_2:1623328_at:290:299; Interrogation_Position=1401; Antisense; CGCCGATGGCTTGTATTGGGACGAA
>probe:Drosophila_2:1623328_at:635:591; Interrogation_Position=1417; Antisense; TGGGACGAAAGCTTGCAGACCTGCA
>probe:Drosophila_2:1623328_at:55:505; Interrogation_Position=1456; Antisense; GTGACCTGCACTCTTTAAATGACCG
>probe:Drosophila_2:1623328_at:5:151; Interrogation_Position=945; Antisense; CACTAAATCCGCAATTGGTTCCTCG
>probe:Drosophila_2:1623328_at:494:467; Interrogation_Position=962; Antisense; GTTCCTCGGCGGTTCAATGTTACGG
>probe:Drosophila_2:1623328_at:472:231; Interrogation_Position=977; Antisense; AATGTTACGGTGACCTCGTCTACAA

Paste this into a BLAST search page for me
GACCAGTGCGACTATCCTGAAAACTAAGTGTAACTTCAACTGCGCCGTCGGCGCCGTCGAGCAATATTGTCCGAAAGGACTATGTTTGCCCGTGGGAGTAAATGCAGGACCTTCGGGAATCGCCTGAGTAATGGCCGTTGCATGGGACAAATGGGACAACGTGAGGGTACCTACTAATTACGTCGTCTGCCAGTGTGAATCGCCGATGGCTTGTATTGGGACGAATGGGACGAAAGCTTGCAGACCTGCAGTGACCTGCACTCTTTAAATGACCGCACTAAATCCGCAATTGGTTCCTCGGTTCCTCGGCGGTTCAATGTTACGGAATGTTACGGTGACCTCGTCTACAA

Full Affymetrix probeset data:

Annotations for 1623328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720