FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623329_at:

>probe:Drosophila_2:1623329_at:729:671; Interrogation_Position=180; Antisense; TACGAGTCGGATCGCCATTGTCGAT
>probe:Drosophila_2:1623329_at:67:709; Interrogation_Position=208; Antisense; TTAACGCCGGACTTCTGAGCATTAG
>probe:Drosophila_2:1623329_at:347:609; Interrogation_Position=223; Antisense; TGAGCATTAGCAATCCAACGGAATT
>probe:Drosophila_2:1623329_at:326:371; Interrogation_Position=261; Antisense; GAATGGCTGCCGATCATTGCACCAT
>probe:Drosophila_2:1623329_at:281:7; Interrogation_Position=276; Antisense; ATTGCACCATACCAGCCGGAGTTCT
>probe:Drosophila_2:1623329_at:343:329; Interrogation_Position=322; Antisense; GCGGAACTTCCGATTACTACTGGCA
>probe:Drosophila_2:1623329_at:202:487; Interrogation_Position=349; Antisense; GTACTGGGCAGAAGGCTGTCTACCT
>probe:Drosophila_2:1623329_at:162:719; Interrogation_Position=413; Antisense; TTGTCTTACACTGATGGCCAACGTC
>probe:Drosophila_2:1623329_at:434:129; Interrogation_Position=438; Antisense; ACCATGACTCCCGAAGAAGCCATAT
>probe:Drosophila_2:1623329_at:634:379; Interrogation_Position=453; Antisense; GAAGCCATATTGAGTGTGCACCGCC
>probe:Drosophila_2:1623329_at:378:653; Interrogation_Position=538; Antisense; TCAAGACCCAGCTTTGTCTCAATAC
>probe:Drosophila_2:1623329_at:674:27; Interrogation_Position=559; Antisense; ATACCACAGCTTTCTTCGAGGCGAA
>probe:Drosophila_2:1623329_at:303:635; Interrogation_Position=574; Antisense; TCGAGGCGAAGATACCCGTTTAAGT
>probe:Drosophila_2:1623329_at:382:313; Interrogation_Position=90; Antisense; GCCAGCGAGGAAACCATTACCCTTT

Paste this into a BLAST search page for me
TACGAGTCGGATCGCCATTGTCGATTTAACGCCGGACTTCTGAGCATTAGTGAGCATTAGCAATCCAACGGAATTGAATGGCTGCCGATCATTGCACCATATTGCACCATACCAGCCGGAGTTCTGCGGAACTTCCGATTACTACTGGCAGTACTGGGCAGAAGGCTGTCTACCTTTGTCTTACACTGATGGCCAACGTCACCATGACTCCCGAAGAAGCCATATGAAGCCATATTGAGTGTGCACCGCCTCAAGACCCAGCTTTGTCTCAATACATACCACAGCTTTCTTCGAGGCGAATCGAGGCGAAGATACCCGTTTAAGTGCCAGCGAGGAAACCATTACCCTTT

Full Affymetrix probeset data:

Annotations for 1623329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720