Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623330_at:

>probe:Drosophila_2:1623330_at:545:557; Interrogation_Position=1338; Antisense; GGACTCGGAGAACTGGTTTCACACC
>probe:Drosophila_2:1623330_at:25:23; Interrogation_Position=1392; Antisense; ATATTTGTTCATTATCGATCGCTTG
>probe:Drosophila_2:1623330_at:71:33; Interrogation_Position=1433; Antisense; ATCAGACCATCATGTATTACCCCAG
>probe:Drosophila_2:1623330_at:125:15; Interrogation_Position=1448; Antisense; ATTACCCCAGCGAGATTGAAAGTGT
>probe:Drosophila_2:1623330_at:344:171; Interrogation_Position=1466; Antisense; AAAGTGTCATCGCTGAAATGCCAAA
>probe:Drosophila_2:1623330_at:387:517; Interrogation_Position=1495; Antisense; GTGGAAGCTTGTGTCTTTGGCATTT
>probe:Drosophila_2:1623330_at:632:497; Interrogation_Position=1507; Antisense; GTCTTTGGCATTTGGGATCCCGTTT
>probe:Drosophila_2:1623330_at:281:699; Interrogation_Position=1529; Antisense; TTTATGGAGATAAGGCAGCCGCTTC
>probe:Drosophila_2:1623330_at:663:567; Interrogation_Position=1542; Antisense; GGCAGCCGCTTCAGTGGTCAAGAAA
>probe:Drosophila_2:1623330_at:50:561; Interrogation_Position=1570; Antisense; GGAACCCAACTAGAGGCCCAGGATG
>probe:Drosophila_2:1623330_at:549:437; Interrogation_Position=1608; Antisense; GAGGAAACGTATACCTGCCAAATTT
>probe:Drosophila_2:1623330_at:683:117; Interrogation_Position=1701; Antisense; AGCGGCCACAAAAGCTGAGTTTTTA
>probe:Drosophila_2:1623330_at:694:213; Interrogation_Position=1838; Antisense; AAGAGGTTCGCCATCTTAGGCATTT
>probe:Drosophila_2:1623330_at:691:343; Interrogation_Position=1857; Antisense; GCATTTTTTCATATTCGCCGAGTAA

Paste this into a BLAST search page for me
GGACTCGGAGAACTGGTTTCACACCATATTTGTTCATTATCGATCGCTTGATCAGACCATCATGTATTACCCCAGATTACCCCAGCGAGATTGAAAGTGTAAAGTGTCATCGCTGAAATGCCAAAGTGGAAGCTTGTGTCTTTGGCATTTGTCTTTGGCATTTGGGATCCCGTTTTTTATGGAGATAAGGCAGCCGCTTCGGCAGCCGCTTCAGTGGTCAAGAAAGGAACCCAACTAGAGGCCCAGGATGGAGGAAACGTATACCTGCCAAATTTAGCGGCCACAAAAGCTGAGTTTTTAAAGAGGTTCGCCATCTTAGGCATTTGCATTTTTTCATATTCGCCGAGTAA

Full Affymetrix probeset data:

Annotations for 1623330_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime