Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623331_at:

>probe:Drosophila_2:1623331_at:302:59; Interrogation_Position=1171; Antisense; ATGATTGCTTTTCAGGGCACCACAG
>probe:Drosophila_2:1623331_at:211:355; Interrogation_Position=1195; Antisense; GCACCTTTCACTTTGAGCATCAATC
>probe:Drosophila_2:1623331_at:485:447; Interrogation_Position=1248; Antisense; GATGCGCGATAACATGGTCCTGTAC
>probe:Drosophila_2:1623331_at:387:631; Interrogation_Position=1265; Antisense; TCCTGTACCTGACCAATTACGGACT
>probe:Drosophila_2:1623331_at:716:211; Interrogation_Position=1335; Antisense; AAGACCTCCAGACTTTTTTGCTGAT
>probe:Drosophila_2:1623331_at:383:621; Interrogation_Position=1353; Antisense; TGCTGATTTCGGAGGCGATCGCATA
>probe:Drosophila_2:1623331_at:472:709; Interrogation_Position=1387; Antisense; TTAATCTACGCATCTGACATTCCTT
>probe:Drosophila_2:1623331_at:648:177; Interrogation_Position=1435; Antisense; AAACTTAAGATTGCCGTGCAGCCCA
>probe:Drosophila_2:1623331_at:301:541; Interrogation_Position=1481; Antisense; GGTTCAACTTGAATCACGCCGGAGA
>probe:Drosophila_2:1623331_at:454:551; Interrogation_Position=1501; Antisense; GGAGAGCCTGATCCGCTAACAGAAC
>probe:Drosophila_2:1623331_at:532:107; Interrogation_Position=1521; Antisense; AGAACATTCCGTTTGTCCTGTCGTC
>probe:Drosophila_2:1623331_at:387:639; Interrogation_Position=1541; Antisense; TCGTCCTGGGCTCCAGATGGATAAT
>probe:Drosophila_2:1623331_at:134:169; Interrogation_Position=1570; Antisense; AAATGGATCCACGAACGCCAGCAAG
>probe:Drosophila_2:1623331_at:132:209; Interrogation_Position=1600; Antisense; AAGAAGCCTTGTTTAGCCTAATATA

Paste this into a BLAST search page for me
ATGATTGCTTTTCAGGGCACCACAGGCACCTTTCACTTTGAGCATCAATCGATGCGCGATAACATGGTCCTGTACTCCTGTACCTGACCAATTACGGACTAAGACCTCCAGACTTTTTTGCTGATTGCTGATTTCGGAGGCGATCGCATATTAATCTACGCATCTGACATTCCTTAAACTTAAGATTGCCGTGCAGCCCAGGTTCAACTTGAATCACGCCGGAGAGGAGAGCCTGATCCGCTAACAGAACAGAACATTCCGTTTGTCCTGTCGTCTCGTCCTGGGCTCCAGATGGATAATAAATGGATCCACGAACGCCAGCAAGAAGAAGCCTTGTTTAGCCTAATATA

Full Affymetrix probeset data:

Annotations for 1623331_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime