Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623332_at:

>probe:Drosophila_2:1623332_at:377:261; Interrogation_Position=105; Antisense; CACCGCGCAGATGGTCTACGAGGAT
>probe:Drosophila_2:1623332_at:550:375; Interrogation_Position=157; Antisense; GAAGAGGATGCTGCTACCCTGAGGT
>probe:Drosophila_2:1623332_at:583:175; Interrogation_Position=193; Antisense; AAACTGGGTCTTTGGACGGATGAGA
>probe:Drosophila_2:1623332_at:567:433; Interrogation_Position=216; Antisense; GAGTGGCTACAATGCCAGGCGGATA
>probe:Drosophila_2:1623332_at:238:97; Interrogation_Position=245; Antisense; AGATCTTTGCCGGACACAACCAGAT
>probe:Drosophila_2:1623332_at:656:405; Interrogation_Position=26; Antisense; GACTGGAGATCATCTGCTGGAGCTG
>probe:Drosophila_2:1623332_at:37:589; Interrogation_Position=290; Antisense; TGGAGCACTGCAACCGGATGGAGCA
>probe:Drosophila_2:1623332_at:12:549; Interrogation_Position=305; Antisense; GGATGGAGCAGGACACGAGCCACCT
>probe:Drosophila_2:1623332_at:525:79; Interrogation_Position=355; Antisense; AGGTGCGCCACTTCCGGGCAGTTTG
>probe:Drosophila_2:1623332_at:125:729; Interrogation_Position=377; Antisense; TTGGCCATTGGGTCAAGGACTTCAT
>probe:Drosophila_2:1623332_at:610:553; Interrogation_Position=44; Antisense; GGAGCTGCCTGCTTATTGCGATGGC
>probe:Drosophila_2:1623332_at:166:623; Interrogation_Position=60; Antisense; TGCGATGGCTGTTAGCACGGAAGCT
>probe:Drosophila_2:1623332_at:603:287; Interrogation_Position=77; Antisense; CGGAAGCTGCTTCTGTTTGGAAACT
>probe:Drosophila_2:1623332_at:161:601; Interrogation_Position=90; Antisense; TGTTTGGAAACTACCCACCGCGCAG

Paste this into a BLAST search page for me
CACCGCGCAGATGGTCTACGAGGATGAAGAGGATGCTGCTACCCTGAGGTAAACTGGGTCTTTGGACGGATGAGAGAGTGGCTACAATGCCAGGCGGATAAGATCTTTGCCGGACACAACCAGATGACTGGAGATCATCTGCTGGAGCTGTGGAGCACTGCAACCGGATGGAGCAGGATGGAGCAGGACACGAGCCACCTAGGTGCGCCACTTCCGGGCAGTTTGTTGGCCATTGGGTCAAGGACTTCATGGAGCTGCCTGCTTATTGCGATGGCTGCGATGGCTGTTAGCACGGAAGCTCGGAAGCTGCTTCTGTTTGGAAACTTGTTTGGAAACTACCCACCGCGCAG

Full Affymetrix probeset data:

Annotations for 1623332_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime