FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623336_at:

>probe:Drosophila_2:1623336_at:79:85; Interrogation_Position=101; Antisense; AGTGGGCACTGCACCACCAGAACCA
>probe:Drosophila_2:1623336_at:297:107; Interrogation_Position=119; Antisense; AGAACCACTTGAACCAAACACCGCG
>probe:Drosophila_2:1623336_at:489:627; Interrogation_Position=145; Antisense; TCCACCGGCAGGCAAACCATGCTGG
>probe:Drosophila_2:1623336_at:165:131; Interrogation_Position=148; Antisense; ACCGGCAGGCAAACCATGCTGGGCA
>probe:Drosophila_2:1623336_at:454:51; Interrogation_Position=163; Antisense; ATGCTGGGCAGCAACCATAGTAGCC
>probe:Drosophila_2:1623336_at:133:351; Interrogation_Position=170; Antisense; GCAGCAACCATAGTAGCCAGCGGGA
>probe:Drosophila_2:1623336_at:293:201; Interrogation_Position=175; Antisense; AACCATAGTAGCCAGCGGGAGACGA
>probe:Drosophila_2:1623336_at:160:91; Interrogation_Position=181; Antisense; AGTAGCCAGCGGGAGACGAGCGTCT
>probe:Drosophila_2:1623336_at:564:631; Interrogation_Position=238; Antisense; TCGGGATCCACCACCGGATTCGGTT
>probe:Drosophila_2:1623336_at:652:447; Interrogation_Position=242; Antisense; GATCCACCACCGGATTCGGTTTCGA
>probe:Drosophila_2:1623336_at:235:649; Interrogation_Position=30; Antisense; TCAGCGGCACGGTCGACCTGCACCA
>probe:Drosophila_2:1623336_at:653:127; Interrogation_Position=59; Antisense; ACCAACACAGCCAGCACAATCAGCA
>probe:Drosophila_2:1623336_at:690:127; Interrogation_Position=86; Antisense; ACCAGCACCAGAACCAGTGGGCACT
>probe:Drosophila_2:1623336_at:251:113; Interrogation_Position=89; Antisense; AGCACCAGAACCAGTGGGCACTGCA

Paste this into a BLAST search page for me
AGTGGGCACTGCACCACCAGAACCAAGAACCACTTGAACCAAACACCGCGTCCACCGGCAGGCAAACCATGCTGGACCGGCAGGCAAACCATGCTGGGCAATGCTGGGCAGCAACCATAGTAGCCGCAGCAACCATAGTAGCCAGCGGGAAACCATAGTAGCCAGCGGGAGACGAAGTAGCCAGCGGGAGACGAGCGTCTTCGGGATCCACCACCGGATTCGGTTGATCCACCACCGGATTCGGTTTCGATCAGCGGCACGGTCGACCTGCACCAACCAACACAGCCAGCACAATCAGCAACCAGCACCAGAACCAGTGGGCACTAGCACCAGAACCAGTGGGCACTGCA

Full Affymetrix probeset data:

Annotations for 1623336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720