FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623339_at:

>probe:Drosophila_2:1623339_at:538:325; Interrogation_Position=288; Antisense; GCGACATCAGTCAAGCGGCCGAAAG
>probe:Drosophila_2:1623339_at:257:353; Interrogation_Position=324; Antisense; GCAGCATCATCAGCTCGATAAGTTT
>probe:Drosophila_2:1623339_at:483:253; Interrogation_Position=462; Antisense; CAACGTGGGCCGCAATAATGGATCT
>probe:Drosophila_2:1623339_at:662:65; Interrogation_Position=479; Antisense; ATGGATCTAATGGAGCTGCTGCATC
>probe:Drosophila_2:1623339_at:58:121; Interrogation_Position=504; Antisense; AGCTGTTCCTTCACATACTTGACAT
>probe:Drosophila_2:1623339_at:17:653; Interrogation_Position=543; Antisense; TCAAGTTTGCACTGATCACGCTGGT
>probe:Drosophila_2:1623339_at:339:35; Interrogation_Position=557; Antisense; ATCACGCTGGTCATCTATTTCCTGG
>probe:Drosophila_2:1623339_at:286:17; Interrogation_Position=573; Antisense; ATTTCCTGGCCGAGTGGTACATACT
>probe:Drosophila_2:1623339_at:15:197; Interrogation_Position=624; Antisense; AACTGGACGCCCATCTGGTGGAAGG
>probe:Drosophila_2:1623339_at:132:249; Interrogation_Position=703; Antisense; CAAGGTGTTTCGCTTCGTGGTGAAC
>probe:Drosophila_2:1623339_at:235:385; Interrogation_Position=724; Antisense; GAACTTTTTCATCCTCTAAGCGACT
>probe:Drosophila_2:1623339_at:715:311; Interrogation_Position=757; Antisense; GCCACTTGTCAAGGTCAATCGCAAA
>probe:Drosophila_2:1623339_at:216:365; Interrogation_Position=793; Antisense; GAATCGGTTGCTTTTTCGCGGAATT
>probe:Drosophila_2:1623339_at:66:281; Interrogation_Position=842; Antisense; CTCAAGGCTCCCGTCAAGAGAATGT

Paste this into a BLAST search page for me
GCGACATCAGTCAAGCGGCCGAAAGGCAGCATCATCAGCTCGATAAGTTTCAACGTGGGCCGCAATAATGGATCTATGGATCTAATGGAGCTGCTGCATCAGCTGTTCCTTCACATACTTGACATTCAAGTTTGCACTGATCACGCTGGTATCACGCTGGTCATCTATTTCCTGGATTTCCTGGCCGAGTGGTACATACTAACTGGACGCCCATCTGGTGGAAGGCAAGGTGTTTCGCTTCGTGGTGAACGAACTTTTTCATCCTCTAAGCGACTGCCACTTGTCAAGGTCAATCGCAAAGAATCGGTTGCTTTTTCGCGGAATTCTCAAGGCTCCCGTCAAGAGAATGT

Full Affymetrix probeset data:

Annotations for 1623339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720