Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623340_at:

>probe:Drosophila_2:1623340_at:651:177; Interrogation_Position=1190; Antisense; AAACTACGACGAGGCCTTTGATGAT
>probe:Drosophila_2:1623340_at:167:657; Interrogation_Position=1235; Antisense; TAAGAAACCGGCCACTGCTGAAGAA
>probe:Drosophila_2:1623340_at:681:167; Interrogation_Position=1285; Antisense; AAATGTGTACAGTGGGCGATCAGTC
>probe:Drosophila_2:1623340_at:598:241; Interrogation_Position=1348; Antisense; AATACCTATCGTGCTTTCATGTTGA
>probe:Drosophila_2:1623340_at:499:655; Interrogation_Position=1385; Antisense; TAATATTGCCATGGCCATGGCCCGT
>probe:Drosophila_2:1623340_at:699:523; Interrogation_Position=1412; Antisense; GGGCATCGCCGATATGAGTCTGCAC
>probe:Drosophila_2:1623340_at:501:23; Interrogation_Position=1423; Antisense; ATATGAGTCTGCACGCCGACGAGGA
>probe:Drosophila_2:1623340_at:669:507; Interrogation_Position=1454; Antisense; GTGCGGCATCGATGGTGATAACGCT
>probe:Drosophila_2:1623340_at:494:341; Interrogation_Position=1476; Antisense; GCTTTGATTCAGTTGCGTCATGTCC
>probe:Drosophila_2:1623340_at:400:329; Interrogation_Position=1490; Antisense; GCGTCATGTCCTCGAGGATCGTAAT
>probe:Drosophila_2:1623340_at:672:9; Interrogation_Position=1507; Antisense; ATCGTAATCAAATACGCTCCCACAC
>probe:Drosophila_2:1623340_at:682:157; Interrogation_Position=1528; Antisense; ACACTGACCAGTTGATGCAGGATCA
>probe:Drosophila_2:1623340_at:558:367; Interrogation_Position=1565; Antisense; GAATCGCGATCGGATGCTGGCCCTG
>probe:Drosophila_2:1623340_at:367:315; Interrogation_Position=1595; Antisense; GCCATTTACTTGTTTCGGATGCGGT

Paste this into a BLAST search page for me
AAACTACGACGAGGCCTTTGATGATTAAGAAACCGGCCACTGCTGAAGAAAAATGTGTACAGTGGGCGATCAGTCAATACCTATCGTGCTTTCATGTTGATAATATTGCCATGGCCATGGCCCGTGGGCATCGCCGATATGAGTCTGCACATATGAGTCTGCACGCCGACGAGGAGTGCGGCATCGATGGTGATAACGCTGCTTTGATTCAGTTGCGTCATGTCCGCGTCATGTCCTCGAGGATCGTAATATCGTAATCAAATACGCTCCCACACACACTGACCAGTTGATGCAGGATCAGAATCGCGATCGGATGCTGGCCCTGGCCATTTACTTGTTTCGGATGCGGT

Full Affymetrix probeset data:

Annotations for 1623340_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime