Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623341_at:

>probe:Drosophila_2:1623341_at:207:337; Interrogation_Position=2481; Antisense; GCTGCCCGGGATGGCCAGGATCAAA
>probe:Drosophila_2:1623341_at:64:183; Interrogation_Position=2503; Antisense; AAAAGGACTGCCAGAGCCTGTACCC
>probe:Drosophila_2:1623341_at:267:415; Interrogation_Position=2516; Antisense; GAGCCTGTACCCACAGTGCAATATG
>probe:Drosophila_2:1623341_at:373:153; Interrogation_Position=2528; Antisense; ACAGTGCAATATGCCGGCCAAGTGA
>probe:Drosophila_2:1623341_at:696:251; Interrogation_Position=2546; Antisense; CAAGTGAGCCGGAGGTCGCCAATTT
>probe:Drosophila_2:1623341_at:163:79; Interrogation_Position=2558; Antisense; AGGTCGCCAATTTTCGGGAGAGAGA
>probe:Drosophila_2:1623341_at:550:243; Interrogation_Position=2755; Antisense; AATTTGCGCTTCTTTGTCACCTAGT
>probe:Drosophila_2:1623341_at:701:495; Interrogation_Position=2770; Antisense; GTCACCTAGTCGCTGCTTTAATATT
>probe:Drosophila_2:1623341_at:324:163; Interrogation_Position=2823; Antisense; AAATTATTCACTTCGATCGGCTGCG
>probe:Drosophila_2:1623341_at:438:17; Interrogation_Position=2838; Antisense; ATCGGCTGCGGTCAGTACACTTTTT
>probe:Drosophila_2:1623341_at:455:709; Interrogation_Position=2861; Antisense; TTAAATTTCCCACCCACTCGTGAAT
>probe:Drosophila_2:1623341_at:452:231; Interrogation_Position=2940; Antisense; AATGTTTATTAATTGGCGGCCAGAC
>probe:Drosophila_2:1623341_at:568:579; Interrogation_Position=2957; Antisense; GGCCAGACGGATGCGGCTGCAAATT
>probe:Drosophila_2:1623341_at:195:101; Interrogation_Position=3011; Antisense; AGAGGAGTTTTTGTCGCCAGCACAT

Paste this into a BLAST search page for me
GCTGCCCGGGATGGCCAGGATCAAAAAAAGGACTGCCAGAGCCTGTACCCGAGCCTGTACCCACAGTGCAATATGACAGTGCAATATGCCGGCCAAGTGACAAGTGAGCCGGAGGTCGCCAATTTAGGTCGCCAATTTTCGGGAGAGAGAAATTTGCGCTTCTTTGTCACCTAGTGTCACCTAGTCGCTGCTTTAATATTAAATTATTCACTTCGATCGGCTGCGATCGGCTGCGGTCAGTACACTTTTTTTAAATTTCCCACCCACTCGTGAATAATGTTTATTAATTGGCGGCCAGACGGCCAGACGGATGCGGCTGCAAATTAGAGGAGTTTTTGTCGCCAGCACAT

Full Affymetrix probeset data:

Annotations for 1623341_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime