FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623342_at:

>probe:Drosophila_2:1623342_at:23:641; Interrogation_Position=103; Antisense; TCTGTTTGCTTTTCTAGCACTGTGC
>probe:Drosophila_2:1623342_at:430:113; Interrogation_Position=118; Antisense; AGCACTGTGCTTGCTGGCATTCGTC
>probe:Drosophila_2:1623342_at:312:309; Interrogation_Position=15; Antisense; TCGAAGCCGGTTTTTGCGAAAGTCA
>probe:Drosophila_2:1623342_at:660:225; Interrogation_Position=158; Antisense; AAGGACACCAAGAAGCCGGCCACCA
>probe:Drosophila_2:1623342_at:425:469; Interrogation_Position=186; Antisense; GTTGCCAGCACAACTGCGGTGAAGT
>probe:Drosophila_2:1623342_at:385:623; Interrogation_Position=200; Antisense; TGCGGTGAAGTCTACGAGCCCGTTT
>probe:Drosophila_2:1623342_at:515:411; Interrogation_Position=215; Antisense; GAGCCCGTTTGTGCCAAGGCCAAAA
>probe:Drosophila_2:1623342_at:614:505; Interrogation_Position=277; Antisense; GTGCGTCATGGCCAACTACAACTGC
>probe:Drosophila_2:1623342_at:372:665; Interrogation_Position=293; Antisense; TACAACTGCCAGCATGCCGACGATC
>probe:Drosophila_2:1623342_at:169:449; Interrogation_Position=314; Antisense; GATCCATTCGAGCAGAAGTCCAAGG
>probe:Drosophila_2:1623342_at:388:519; Interrogation_Position=351; Antisense; GTGGAGTGAGCGTTCGCCTGTCCTA
>probe:Drosophila_2:1623342_at:184:317; Interrogation_Position=366; Antisense; GCCTGTCCTAGAAGTCCAATTTCAA
>probe:Drosophila_2:1623342_at:322:179; Interrogation_Position=405; Antisense; AAACATCTTTCACTGATTGTGCAAT
>probe:Drosophila_2:1623342_at:396:255; Interrogation_Position=88; Antisense; CAAAATGCGTTTCGCTCTGTTTGCT

Paste this into a BLAST search page for me
TCTGTTTGCTTTTCTAGCACTGTGCAGCACTGTGCTTGCTGGCATTCGTCTCGAAGCCGGTTTTTGCGAAAGTCAAAGGACACCAAGAAGCCGGCCACCAGTTGCCAGCACAACTGCGGTGAAGTTGCGGTGAAGTCTACGAGCCCGTTTGAGCCCGTTTGTGCCAAGGCCAAAAGTGCGTCATGGCCAACTACAACTGCTACAACTGCCAGCATGCCGACGATCGATCCATTCGAGCAGAAGTCCAAGGGTGGAGTGAGCGTTCGCCTGTCCTAGCCTGTCCTAGAAGTCCAATTTCAAAAACATCTTTCACTGATTGTGCAATCAAAATGCGTTTCGCTCTGTTTGCT

Full Affymetrix probeset data:

Annotations for 1623342_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720