FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623343_at:

>probe:Drosophila_2:1623343_at:670:661; Interrogation_Position=4352; Antisense; TAACATACTCACAGCCACAGCAGTC
>probe:Drosophila_2:1623343_at:190:321; Interrogation_Position=4431; Antisense; GCCGCCGGCATACAAGCATCAGAAC
>probe:Drosophila_2:1623343_at:380:577; Interrogation_Position=4464; Antisense; GGCCGCCGGCGAAGGTTACAGCAAC
>probe:Drosophila_2:1623343_at:174:653; Interrogation_Position=4491; Antisense; TAATAGTATTCAGCCCAATGTGCCG
>probe:Drosophila_2:1623343_at:117:313; Interrogation_Position=4560; Antisense; GCCAGCGGATAGTTCGTACTTCCAG
>probe:Drosophila_2:1623343_at:433:537; Interrogation_Position=4660; Antisense; GGTTCCGGCTACCACATTAATAACT
>probe:Drosophila_2:1623343_at:481:31; Interrogation_Position=4679; Antisense; ATAACTACACCTCATACGGCAATCT
>probe:Drosophila_2:1623343_at:723:563; Interrogation_Position=4696; Antisense; GGCAATCTAAATTTCGCACCGTACC
>probe:Drosophila_2:1623343_at:446:477; Interrogation_Position=4761; Antisense; GTCGTCCTACGTGAACTCGAATGTT
>probe:Drosophila_2:1623343_at:526:93; Interrogation_Position=4804; Antisense; AGTTCGGTTGTTAACTCCTCACCAG
>probe:Drosophila_2:1623343_at:372:649; Interrogation_Position=4822; Antisense; TCACCAGCGTCAAGCGAGTCTATGC
>probe:Drosophila_2:1623343_at:246:51; Interrogation_Position=4843; Antisense; ATGCGACAGCCATCGTACATCGGTA
>probe:Drosophila_2:1623343_at:429:659; Interrogation_Position=4858; Antisense; TACATCGGTAGTACTTACCCCGTCA
>probe:Drosophila_2:1623343_at:17:707; Interrogation_Position=4872; Antisense; TTACCCCGTCAACGAATGGTCGTCG

Paste this into a BLAST search page for me
TAACATACTCACAGCCACAGCAGTCGCCGCCGGCATACAAGCATCAGAACGGCCGCCGGCGAAGGTTACAGCAACTAATAGTATTCAGCCCAATGTGCCGGCCAGCGGATAGTTCGTACTTCCAGGGTTCCGGCTACCACATTAATAACTATAACTACACCTCATACGGCAATCTGGCAATCTAAATTTCGCACCGTACCGTCGTCCTACGTGAACTCGAATGTTAGTTCGGTTGTTAACTCCTCACCAGTCACCAGCGTCAAGCGAGTCTATGCATGCGACAGCCATCGTACATCGGTATACATCGGTAGTACTTACCCCGTCATTACCCCGTCAACGAATGGTCGTCG

Full Affymetrix probeset data:

Annotations for 1623343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720